Incidental Mutation 'R7454:Ccdc7a'
ID578003
Institutional Source Beutler Lab
Gene Symbol Ccdc7a
Ensembl Gene ENSMUSG00000025808
Gene Namecoiled-coil domain containing 7A
SynonymsCcdc7, 4930517G15Rik, 4930540C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7454 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location128734235-129065517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128944516 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 503 (M503T)
Ref Sequence ENSEMBL: ENSMUSP00000149790 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000214889
AA Change: M503T
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (90/90)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,836,851 E57G possibly damaging Het
4932414N04Rik C A 2: 68,688,304 T159K unknown Het
Adamts10 T A 17: 33,545,005 F616L possibly damaging Het
Adtrp G A 13: 41,828,315 S26L unknown Het
Alpk3 A C 7: 81,078,562 E480A probably benign Het
Anks6 T C 4: 47,038,919 T529A unknown Het
Arl4d A G 11: 101,666,660 H4R probably benign Het
Ash1l A G 3: 88,983,865 H1017R probably benign Het
Bbs12 T C 3: 37,320,953 S517P possibly damaging Het
Bcl11b C A 12: 107,916,208 R616L possibly damaging Het
Bean1 G A 8: 104,211,026 G79D probably damaging Het
Bicra C G 7: 15,972,134 G1461R probably benign Het
Bptf T C 11: 107,044,640 T124A probably benign Het
Btnl4 A T 17: 34,472,374 V312E probably benign Het
Celf5 T C 10: 81,482,523 E28G probably damaging Het
Cilp2 G A 8: 69,883,390 L350F probably damaging Het
Clec4a2 T C 6: 123,142,452 I245T probably damaging Het
Ctnnal1 A T 4: 56,844,544 V140D probably damaging Het
Dennd4a A C 9: 64,852,570 H319P probably damaging Het
Dlgap3 G T 4: 127,235,059 L857F probably null Het
Dnah6 T A 6: 73,212,492 T58S probably damaging Het
Dnah7a T A 1: 53,518,764 M2164L probably benign Het
Dspp T A 5: 104,175,610 H206Q probably benign Het
Dzip1l G A 9: 99,659,674 V443M possibly damaging Het
Erc2 A G 14: 28,302,991 H939R possibly damaging Het
Fam149a G T 8: 45,348,546 H513N probably benign Het
Fam171a2 T C 11: 102,439,717 T280A possibly damaging Het
Fam208b A G 13: 3,585,332 S492P probably benign Het
Fkbp5 A C 17: 28,416,025 V170G probably damaging Het
Fnbp4 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC 2: 90,777,815 probably benign Het
Fzd2 T C 11: 102,605,129 F133S probably damaging Het
Galm A G 17: 80,138,121 N100S possibly damaging Het
Gbp2b T A 3: 142,598,159 I5N possibly damaging Het
Gga2 T C 7: 122,002,146 R245G probably benign Het
Gm10053 A G 19: 24,875,900 T50A probably benign Het
Gm1110 T C 9: 26,920,649 T69A probably benign Het
Gm15922 T G 7: 3,735,510 E622D probably benign Het
Heatr5a T C 12: 51,961,543 S6G probably benign Het
Hmcn1 A G 1: 150,563,604 S5610P probably damaging Het
Hmgb4 A G 4: 128,260,406 V123A probably damaging Het
Itgal C A 7: 127,327,764 Q943K probably benign Het
Jakmip1 C A 5: 37,175,154 D1059E probably damaging Het
Jazf1 T C 6: 52,893,944 probably null Het
Kat6a A G 8: 22,935,772 E1111G possibly damaging Het
Kdm4b C A 17: 56,389,639 P452T probably benign Het
Krit1 T C 5: 3,812,474 Y210H probably damaging Het
Krtap6-2 A T 16: 89,419,912 Y56N unknown Het
Lig1 A T 7: 13,288,721 D158V probably damaging Het
Lmo1 A T 7: 109,140,666 L94Q probably benign Het
Lrrc30 A T 17: 67,632,243 L114H probably damaging Het
Ltn1 T C 16: 87,397,812 I1400V probably benign Het
Mark3 T C 12: 111,604,527 I87T probably damaging Het
Mfrp G T 9: 44,105,183 V392F possibly damaging Het
Mrgprg A G 7: 143,765,135 L80P probably damaging Het
Ndufaf3 A T 9: 108,566,926 M1K probably null Het
Nme7 T A 1: 164,380,648 L295* probably null Het
Noct G T 3: 51,249,730 C163F probably damaging Het
Olfr1270 T A 2: 90,149,419 I196F possibly damaging Het
Olfr229 A G 9: 39,909,904 I34V probably benign Het
Olfr541 A T 7: 140,704,634 I128F probably damaging Het
Olfr747 T A 14: 50,680,824 Q270L possibly damaging Het
Olfr772 T A 10: 129,174,455 T189S probably damaging Het
Olfr992 T A 2: 85,399,611 K307N probably damaging Het
Patz1 C T 11: 3,298,297 probably benign Het
Per3 A G 4: 151,012,728 L780P probably benign Het
Pla2g4a T C 1: 149,872,690 M256V possibly damaging Het
Pnliprp1 A G 19: 58,741,100 K395R probably benign Het
Poc5 G T 13: 96,400,832 G242V possibly damaging Het
Ppfia4 A G 1: 134,324,135 S434P possibly damaging Het
Prss42 A G 9: 110,798,829 N110S probably benign Het
Ralgapb T A 2: 158,432,902 I241N possibly damaging Het
Rbak A C 5: 143,173,773 Y508* probably null Het
S1pr2 G T 9: 20,967,549 R328S possibly damaging Het
Sap130 T C 18: 31,650,512 M214T probably benign Het
Slc46a1 T A 11: 78,466,511 V130E probably damaging Het
Smc4 A T 3: 69,018,124 H343L probably benign Het
Tarbp1 C A 8: 126,457,677 R500L probably benign Het
Tgfbr3 A T 5: 107,215,028 H39Q probably damaging Het
Tpp2 T C 1: 43,954,659 S235P probably benign Het
Trbc2 G T 6: 41,546,829 R33M Het
Trim3 C T 7: 105,619,558 R63Q probably damaging Het
Ttc28 T C 5: 111,285,484 V2128A probably benign Het
Ttn C T 2: 76,725,818 R30281H probably damaging Het
Ttn T A 2: 76,944,139 Q2187L unknown Het
Ttyh3 T C 5: 140,629,425 S403G possibly damaging Het
Vmn2r112 A T 17: 22,603,307 D322V probably benign Het
Wdr38 C T 2: 38,998,340 probably benign Het
Xrn1 T A 9: 96,048,358 S1543R probably benign Het
Zbtb8b G A 4: 129,432,769 T201I possibly damaging Het
Other mutations in Ccdc7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Ccdc7a APN 8 129026754 splice site probably benign
IGL01019:Ccdc7a APN 8 129061618 missense probably benign 0.05
IGL01553:Ccdc7a APN 8 129026591 splice site probably benign
IGL01577:Ccdc7a APN 8 128988763 missense probably damaging 0.96
IGL03114:Ccdc7a APN 8 129026689 missense possibly damaging 0.62
IGL03323:Ccdc7a APN 8 129058763 missense probably benign 0.02
R1517:Ccdc7a UTSW 8 129061681 missense probably damaging 0.99
R1804:Ccdc7a UTSW 8 128988766 nonsense probably null
R1957:Ccdc7a UTSW 8 128980135 missense probably damaging 0.99
R4926:Ccdc7a UTSW 8 128980054 intron probably benign
R4981:Ccdc7a UTSW 8 128984983 missense probably benign 0.35
R5193:Ccdc7a UTSW 8 128988797 missense probably benign 0.02
R5273:Ccdc7a UTSW 8 129061609 frame shift probably null
R5486:Ccdc7a UTSW 8 128985403 missense probably damaging 0.98
R5505:Ccdc7a UTSW 8 128980174 missense possibly damaging 0.73
R5562:Ccdc7a UTSW 8 129058785 missense possibly damaging 0.79
R5704:Ccdc7a UTSW 8 128980096 splice site probably benign
R6256:Ccdc7a UTSW 8 128935593 intron probably null
R6273:Ccdc7a UTSW 8 128787338 missense probably damaging 0.97
R6366:Ccdc7a UTSW 8 128855992 missense unknown
R6455:Ccdc7a UTSW 8 128832610 missense probably damaging 0.97
R6778:Ccdc7a UTSW 8 128821120 missense possibly damaging 0.66
R6882:Ccdc7a UTSW 8 128797328 intron probably benign
R6891:Ccdc7a UTSW 8 129026638 missense probably damaging 1.00
R6906:Ccdc7a UTSW 8 128935681 missense unknown
R7028:Ccdc7a UTSW 8 128881594 missense unknown
R7046:Ccdc7a UTSW 8 129047619 missense probably damaging 0.99
R7073:Ccdc7a UTSW 8 128892385 missense possibly damaging 0.46
R7268:Ccdc7a UTSW 8 128881152 missense possibly damaging 0.66
R7643:Ccdc7a UTSW 8 128889811 missense probably damaging 1.00
R7733:Ccdc7a UTSW 8 128993052 missense probably damaging 1.00
R7792:Ccdc7a UTSW 8 128892437 missense possibly damaging 0.81
R7902:Ccdc7a UTSW 8 128836173 missense possibly damaging 0.46
R7985:Ccdc7a UTSW 8 128836173 missense possibly damaging 0.46
R8032:Ccdc7a UTSW 8 128825383 missense not run
RF008:Ccdc7a UTSW 8 128964953 missense probably damaging 0.99
Z1176:Ccdc7a UTSW 8 129026663 missense not run
Z1177:Ccdc7a UTSW 8 128807924 missense not run
Predicted Primers PCR Primer
(F):5'- GCACATGGACTGTTTAGCCTTTC -3'
(R):5'- AAGTCCAATGTTCTCCACCTAATC -3'

Sequencing Primer
(F):5'- GCTAAAAATTTCCCTCATCCCATG -3'
(R):5'- ATGTTCTCCACCTAATCTAACACTAG -3'
Posted On2019-10-07