Incidental Mutation 'R7454:Mfrp'
ID578007
Institutional Source Beutler Lab
Gene Symbol Mfrp
Ensembl Gene ENSMUSG00000034739
Gene Namemembrane frizzled-related protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R7454 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44101729-44109187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44105183 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 392 (V392F)
Ref Sequence ENSEMBL: ENSMUSP00000034654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034654] [ENSMUST00000065379] [ENSMUST00000114815] [ENSMUST00000114816] [ENSMUST00000114818] [ENSMUST00000114821] [ENSMUST00000152956] [ENSMUST00000161381] [ENSMUST00000161703] [ENSMUST00000162126] [ENSMUST00000185479] [ENSMUST00000205282] [ENSMUST00000205500] [ENSMUST00000206295] [ENSMUST00000206308] [ENSMUST00000206769]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034654
AA Change: V392F

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034654
Gene: ENSMUSG00000034739
AA Change: V392F

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
CUB 307 420 1.85e-37 SMART
Pfam:Fz 471 577 3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065379
SMART Domains Protein: ENSMUSP00000070060
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114815
SMART Domains Protein: ENSMUSP00000110463
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114816
SMART Domains Protein: ENSMUSP00000110464
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114818
SMART Domains Protein: ENSMUSP00000110466
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114821
SMART Domains Protein: ENSMUSP00000110469
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 220 1.01e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152956
SMART Domains Protein: ENSMUSP00000123040
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Collagen 28 102 7.2e-10 PFAM
Pfam:C1q 105 138 1.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160985
SMART Domains Protein: ENSMUSP00000124568
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
RING 11 52 1.57e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161381
AA Change: V392F

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124456
Gene: ENSMUSG00000034739
AA Change: V392F

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
CUB 307 420 1.85e-37 SMART
Pfam:Fz 465 576 9.1e-22 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000125053
Gene: ENSMUSG00000034739
AA Change: L316F

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
LDLa 307 342 2.09e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162126
SMART Domains Protein: ENSMUSP00000123938
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185479
SMART Domains Protein: ENSMUSP00000140405
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205282
Predicted Effect probably benign
Transcript: ENSMUST00000205500
Predicted Effect probably benign
Transcript: ENSMUST00000206295
Predicted Effect possibly damaging
Transcript: ENSMUST00000206308
AA Change: V392F

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000206722
AA Change: V3F

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000206769
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains a region with similarity to the cysteine-rich domain (CRD) of frizzled, a gene originally found in Drosophila that controls tissue polarity. This protein functions in eye development, where it is necessary for the maintenance of photoreceptor outer segments. Mutations in this gene cause retinal degeneration 6 in mice, which gives rise to a mouse model for human retinitis punctata albescens. Bicistronic transcripts composed of the coding sequences for this gene (Mfrp) and the C1q and tumor necrosis factor related protein 5 gene (C1qtnf5) have been identified, and the resulting products can interact with each other. Co-transcription of C1qtnf5 and Mfrp has been observed in both human and mouse. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mutations produce mice having small, white retinal spots and progressive photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,836,851 E57G possibly damaging Het
4932414N04Rik C A 2: 68,688,304 T159K unknown Het
Adamts10 T A 17: 33,545,005 F616L possibly damaging Het
Adtrp G A 13: 41,828,315 S26L unknown Het
Alpk3 A C 7: 81,078,562 E480A probably benign Het
Anks6 T C 4: 47,038,919 T529A unknown Het
Arl4d A G 11: 101,666,660 H4R probably benign Het
Ash1l A G 3: 88,983,865 H1017R probably benign Het
Bbs12 T C 3: 37,320,953 S517P possibly damaging Het
Bcl11b C A 12: 107,916,208 R616L possibly damaging Het
Bean1 G A 8: 104,211,026 G79D probably damaging Het
Bicra C G 7: 15,972,134 G1461R probably benign Het
Bptf T C 11: 107,044,640 T124A probably benign Het
Btnl4 A T 17: 34,472,374 V312E probably benign Het
Ccdc7a A G 8: 128,944,516 M503T unknown Het
Celf5 T C 10: 81,482,523 E28G probably damaging Het
Cilp2 G A 8: 69,883,390 L350F probably damaging Het
Clec4a2 T C 6: 123,142,452 I245T probably damaging Het
Ctnnal1 A T 4: 56,844,544 V140D probably damaging Het
Dennd4a A C 9: 64,852,570 H319P probably damaging Het
Dlgap3 G T 4: 127,235,059 L857F probably null Het
Dnah6 T A 6: 73,212,492 T58S probably damaging Het
Dnah7a T A 1: 53,518,764 M2164L probably benign Het
Dspp T A 5: 104,175,610 H206Q probably benign Het
Dzip1l G A 9: 99,659,674 V443M possibly damaging Het
Erc2 A G 14: 28,302,991 H939R possibly damaging Het
Fam149a G T 8: 45,348,546 H513N probably benign Het
Fam171a2 T C 11: 102,439,717 T280A possibly damaging Het
Fam208b A G 13: 3,585,332 S492P probably benign Het
Fkbp5 A C 17: 28,416,025 V170G probably damaging Het
Fnbp4 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC 2: 90,777,815 probably benign Het
Fnbp4 ACC ACCCCCCCC 2: 90,777,818 probably benign Het
Fzd2 T C 11: 102,605,129 F133S probably damaging Het
Galm A G 17: 80,138,121 N100S possibly damaging Het
Gbp2b T A 3: 142,598,159 I5N possibly damaging Het
Gga2 T C 7: 122,002,146 R245G probably benign Het
Gm10053 A G 19: 24,875,900 T50A probably benign Het
Gm1110 T C 9: 26,920,649 T69A probably benign Het
Gm15922 T G 7: 3,735,510 E622D probably benign Het
Heatr5a T C 12: 51,961,543 S6G probably benign Het
Hmcn1 A G 1: 150,563,604 S5610P probably damaging Het
Hmgb4 A G 4: 128,260,406 V123A probably damaging Het
Itgal C A 7: 127,327,764 Q943K probably benign Het
Jakmip1 C A 5: 37,175,154 D1059E probably damaging Het
Kat6a A G 8: 22,935,772 E1111G possibly damaging Het
Kdm4b C A 17: 56,389,639 P452T probably benign Het
Krit1 T C 5: 3,812,474 Y210H probably damaging Het
Krtap6-2 A T 16: 89,419,912 Y56N unknown Het
Lig1 A T 7: 13,288,721 D158V probably damaging Het
Lmo1 A T 7: 109,140,666 L94Q probably benign Het
Lrrc30 A T 17: 67,632,243 L114H probably damaging Het
Ltn1 T C 16: 87,397,812 I1400V probably benign Het
Mark3 T C 12: 111,604,527 I87T probably damaging Het
Mrgprg A G 7: 143,765,135 L80P probably damaging Het
Ndufaf3 A T 9: 108,566,926 M1K probably null Het
Nme7 T A 1: 164,380,648 L295* probably null Het
Noct G T 3: 51,249,730 C163F probably damaging Het
Olfr1270 T A 2: 90,149,419 I196F possibly damaging Het
Olfr229 A G 9: 39,909,904 I34V probably benign Het
Olfr541 A T 7: 140,704,634 I128F probably damaging Het
Olfr747 T A 14: 50,680,824 Q270L possibly damaging Het
Olfr772 T A 10: 129,174,455 T189S probably damaging Het
Olfr992 T A 2: 85,399,611 K307N probably damaging Het
Per3 A G 4: 151,012,728 L780P probably benign Het
Pla2g4a T C 1: 149,872,690 M256V possibly damaging Het
Pnliprp1 A G 19: 58,741,100 K395R probably benign Het
Poc5 G T 13: 96,400,832 G242V possibly damaging Het
Ppfia4 A G 1: 134,324,135 S434P possibly damaging Het
Prss42 A G 9: 110,798,829 N110S probably benign Het
Ralgapb T A 2: 158,432,902 I241N possibly damaging Het
Rbak A C 5: 143,173,773 Y508* probably null Het
S1pr2 G T 9: 20,967,549 R328S possibly damaging Het
Sap130 T C 18: 31,650,512 M214T probably benign Het
Slc46a1 T A 11: 78,466,511 V130E probably damaging Het
Smc4 A T 3: 69,018,124 H343L probably benign Het
Tarbp1 C A 8: 126,457,677 R500L probably benign Het
Tgfbr3 A T 5: 107,215,028 H39Q probably damaging Het
Tpp2 T C 1: 43,954,659 S235P probably benign Het
Trbc2 G T 6: 41,546,829 R33M Het
Trim3 C T 7: 105,619,558 R63Q probably damaging Het
Ttc28 T C 5: 111,285,484 V2128A probably benign Het
Ttn C T 2: 76,725,818 R30281H probably damaging Het
Ttn T A 2: 76,944,139 Q2187L unknown Het
Ttyh3 T C 5: 140,629,425 S403G possibly damaging Het
Vmn2r112 A T 17: 22,603,307 D322V probably benign Het
Wdr38 C T 2: 38,998,340 probably benign Het
Xrn1 T A 9: 96,048,358 S1543R probably benign Het
Zbtb8b G A 4: 129,432,769 T201I possibly damaging Het
Other mutations in Mfrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02070:Mfrp APN 9 44104689 missense probably benign 0.39
IGL02077:Mfrp APN 9 44105220 missense probably damaging 1.00
IGL02313:Mfrp APN 9 44102874 missense probably damaging 1.00
IGL02544:Mfrp APN 9 44102794 missense probably damaging 1.00
IGL02709:Mfrp APN 9 44103264 missense probably benign 0.00
R1592:Mfrp UTSW 9 44103222 missense probably damaging 1.00
R1728:Mfrp UTSW 9 44104587 missense possibly damaging 0.73
R1729:Mfrp UTSW 9 44104587 missense possibly damaging 0.73
R1886:Mfrp UTSW 9 44103488 missense possibly damaging 0.94
R1974:Mfrp UTSW 9 44106372 missense probably damaging 1.00
R2146:Mfrp UTSW 9 44103718 missense probably benign 0.12
R2150:Mfrp UTSW 9 44103718 missense probably benign 0.12
R2512:Mfrp UTSW 9 44102538 missense probably benign 0.01
R3788:Mfrp UTSW 9 44105457 nonsense probably null
R4204:Mfrp UTSW 9 44105228 missense possibly damaging 0.86
R4240:Mfrp UTSW 9 44102866 missense possibly damaging 0.91
R4839:Mfrp UTSW 9 44102135 missense possibly damaging 0.89
R4963:Mfrp UTSW 9 44103264 missense probably benign 0.33
R5041:Mfrp UTSW 9 44102278 missense probably damaging 1.00
R6370:Mfrp UTSW 9 44106261 missense probably damaging 1.00
R7420:Mfrp UTSW 9 44102476 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCATCTCAAAGTGGCTCAAGTTTAAG -3'
(R):5'- CACAAAGGTCTGTGGGCAAG -3'

Sequencing Primer
(F):5'- AGTGGCTCAAGTTTAAGAAGTTG -3'
(R):5'- AAGGGGCATGCCTGTACCTAC -3'
Posted On2019-10-07