Incidental Mutation 'R7454:Fam171a2'
ID578017
Institutional Source Beutler Lab
Gene Symbol Fam171a2
Ensembl Gene ENSMUSG00000034685
Gene Namefamily with sequence similarity 171, member A2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7454 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location102436981-102447682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102439717 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 280 (T280A)
Ref Sequence ENSEMBL: ENSMUSP00000038486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049057] [ENSMUST00000049460] [ENSMUST00000125819]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049057
AA Change: T280A

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038486
Gene: ENSMUSG00000034685
AA Change: T280A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UPF0560 41 820 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049460
SMART Domains Protein: ENSMUSP00000046340
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
GRAN 74 125 1.32e-22 SMART
GRAN 138 190 7.38e-26 SMART
GRAN 220 272 5.76e-28 SMART
GRAN 295 346 1.19e-29 SMART
GRAN 377 427 1.84e-26 SMART
GRAN 455 506 7.1e-28 SMART
GRAN 530 581 1.48e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125819
SMART Domains Protein: ENSMUSP00000134948
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
GRAN 42 72 5.03e-4 SMART
GRAN 100 151 7.1e-28 SMART
GRAN 175 226 1.48e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177428
SMART Domains Protein: ENSMUSP00000134893
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
GRAN 1 49 8.68e-23 SMART
GRAN 77 128 7.1e-28 SMART
GRAN 152 180 3.98e-2 SMART
low complexity region 244 259 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (90/90)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,836,851 E57G possibly damaging Het
4932414N04Rik C A 2: 68,688,304 T159K unknown Het
Adamts10 T A 17: 33,545,005 F616L possibly damaging Het
Adtrp G A 13: 41,828,315 S26L unknown Het
Alpk3 A C 7: 81,078,562 E480A probably benign Het
Anks6 T C 4: 47,038,919 T529A unknown Het
Arl4d A G 11: 101,666,660 H4R probably benign Het
Ash1l A G 3: 88,983,865 H1017R probably benign Het
Bbs12 T C 3: 37,320,953 S517P possibly damaging Het
Bcl11b C A 12: 107,916,208 R616L possibly damaging Het
Bean1 G A 8: 104,211,026 G79D probably damaging Het
Bicra C G 7: 15,972,134 G1461R probably benign Het
Bptf T C 11: 107,044,640 T124A probably benign Het
Btnl4 A T 17: 34,472,374 V312E probably benign Het
Ccdc7a A G 8: 128,944,516 M503T unknown Het
Celf5 T C 10: 81,482,523 E28G probably damaging Het
Cilp2 G A 8: 69,883,390 L350F probably damaging Het
Clec4a2 T C 6: 123,142,452 I245T probably damaging Het
Ctnnal1 A T 4: 56,844,544 V140D probably damaging Het
Dennd4a A C 9: 64,852,570 H319P probably damaging Het
Dlgap3 G T 4: 127,235,059 L857F probably null Het
Dnah6 T A 6: 73,212,492 T58S probably damaging Het
Dnah7a T A 1: 53,518,764 M2164L probably benign Het
Dspp T A 5: 104,175,610 H206Q probably benign Het
Dzip1l G A 9: 99,659,674 V443M possibly damaging Het
Erc2 A G 14: 28,302,991 H939R possibly damaging Het
Fam149a G T 8: 45,348,546 H513N probably benign Het
Fam208b A G 13: 3,585,332 S492P probably benign Het
Fkbp5 A C 17: 28,416,025 V170G probably damaging Het
Fnbp4 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC 2: 90,777,815 probably benign Het
Fzd2 T C 11: 102,605,129 F133S probably damaging Het
Galm A G 17: 80,138,121 N100S possibly damaging Het
Gbp2b T A 3: 142,598,159 I5N possibly damaging Het
Gga2 T C 7: 122,002,146 R245G probably benign Het
Gm10053 A G 19: 24,875,900 T50A probably benign Het
Gm1110 T C 9: 26,920,649 T69A probably benign Het
Gm15922 T G 7: 3,735,510 E622D probably benign Het
Heatr5a T C 12: 51,961,543 S6G probably benign Het
Hmcn1 A G 1: 150,563,604 S5610P probably damaging Het
Hmgb4 A G 4: 128,260,406 V123A probably damaging Het
Itgal C A 7: 127,327,764 Q943K probably benign Het
Jakmip1 C A 5: 37,175,154 D1059E probably damaging Het
Jazf1 T C 6: 52,893,944 probably null Het
Kat6a A G 8: 22,935,772 E1111G possibly damaging Het
Kdm4b C A 17: 56,389,639 P452T probably benign Het
Krit1 T C 5: 3,812,474 Y210H probably damaging Het
Krtap6-2 A T 16: 89,419,912 Y56N unknown Het
Lig1 A T 7: 13,288,721 D158V probably damaging Het
Lmo1 A T 7: 109,140,666 L94Q probably benign Het
Lrrc30 A T 17: 67,632,243 L114H probably damaging Het
Ltn1 T C 16: 87,397,812 I1400V probably benign Het
Mark3 T C 12: 111,604,527 I87T probably damaging Het
Mfrp G T 9: 44,105,183 V392F possibly damaging Het
Mrgprg A G 7: 143,765,135 L80P probably damaging Het
Ndufaf3 A T 9: 108,566,926 M1K probably null Het
Nme7 T A 1: 164,380,648 L295* probably null Het
Noct G T 3: 51,249,730 C163F probably damaging Het
Olfr1270 T A 2: 90,149,419 I196F possibly damaging Het
Olfr229 A G 9: 39,909,904 I34V probably benign Het
Olfr541 A T 7: 140,704,634 I128F probably damaging Het
Olfr747 T A 14: 50,680,824 Q270L possibly damaging Het
Olfr772 T A 10: 129,174,455 T189S probably damaging Het
Olfr992 T A 2: 85,399,611 K307N probably damaging Het
Patz1 C T 11: 3,298,297 probably benign Het
Per3 A G 4: 151,012,728 L780P probably benign Het
Pla2g4a T C 1: 149,872,690 M256V possibly damaging Het
Pnliprp1 A G 19: 58,741,100 K395R probably benign Het
Poc5 G T 13: 96,400,832 G242V possibly damaging Het
Ppfia4 A G 1: 134,324,135 S434P possibly damaging Het
Prss42 A G 9: 110,798,829 N110S probably benign Het
Ralgapb T A 2: 158,432,902 I241N possibly damaging Het
Rbak A C 5: 143,173,773 Y508* probably null Het
S1pr2 G T 9: 20,967,549 R328S possibly damaging Het
Sap130 T C 18: 31,650,512 M214T probably benign Het
Slc46a1 T A 11: 78,466,511 V130E probably damaging Het
Smc4 A T 3: 69,018,124 H343L probably benign Het
Tarbp1 C A 8: 126,457,677 R500L probably benign Het
Tgfbr3 A T 5: 107,215,028 H39Q probably damaging Het
Tpp2 T C 1: 43,954,659 S235P probably benign Het
Trbc2 G T 6: 41,546,829 R33M Het
Trim3 C T 7: 105,619,558 R63Q probably damaging Het
Ttc28 T C 5: 111,285,484 V2128A probably benign Het
Ttn C T 2: 76,725,818 R30281H probably damaging Het
Ttn T A 2: 76,944,139 Q2187L unknown Het
Ttyh3 T C 5: 140,629,425 S403G possibly damaging Het
Vmn2r112 A T 17: 22,603,307 D322V probably benign Het
Wdr38 C T 2: 38,998,340 probably benign Het
Xrn1 T A 9: 96,048,358 S1543R probably benign Het
Zbtb8b G A 4: 129,432,769 T201I possibly damaging Het
Other mutations in Fam171a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Fam171a2 APN 11 102437848 missense possibly damaging 0.92
IGL01898:Fam171a2 APN 11 102439756 missense possibly damaging 0.88
IGL02477:Fam171a2 APN 11 102440028 missense probably benign 0.00
IGL03272:Fam171a2 APN 11 102444118 missense possibly damaging 0.58
R0102:Fam171a2 UTSW 11 102444113 missense possibly damaging 0.88
R0102:Fam171a2 UTSW 11 102444113 missense possibly damaging 0.88
R0632:Fam171a2 UTSW 11 102437881 missense probably damaging 0.99
R0733:Fam171a2 UTSW 11 102439722 missense possibly damaging 0.83
R1005:Fam171a2 UTSW 11 102440181 missense probably benign 0.05
R1323:Fam171a2 UTSW 11 102444125 missense probably damaging 0.99
R1323:Fam171a2 UTSW 11 102444125 missense probably damaging 0.99
R2425:Fam171a2 UTSW 11 102438361 missense possibly damaging 0.88
R4838:Fam171a2 UTSW 11 102438685 missense possibly damaging 0.88
R4858:Fam171a2 UTSW 11 102440156 missense probably damaging 1.00
R5119:Fam171a2 UTSW 11 102438733 missense probably damaging 0.97
R5384:Fam171a2 UTSW 11 102437867 missense possibly damaging 0.51
R5386:Fam171a2 UTSW 11 102437867 missense possibly damaging 0.51
R5408:Fam171a2 UTSW 11 102437518 missense possibly damaging 0.71
R5457:Fam171a2 UTSW 11 102437536 missense possibly damaging 0.92
R5732:Fam171a2 UTSW 11 102439981 missense possibly damaging 0.94
R6466:Fam171a2 UTSW 11 102439885 missense probably damaging 1.00
R6931:Fam171a2 UTSW 11 102438434 missense possibly damaging 0.95
R7196:Fam171a2 UTSW 11 102438346 missense probably benign 0.04
R7261:Fam171a2 UTSW 11 102438074 missense probably damaging 0.98
R7295:Fam171a2 UTSW 11 102438238 missense possibly damaging 0.85
R7419:Fam171a2 UTSW 11 102438802 missense possibly damaging 0.95
R7422:Fam171a2 UTSW 11 102438665 missense probably benign 0.29
R7606:Fam171a2 UTSW 11 102444176 missense possibly damaging 0.75
R7690:Fam171a2 UTSW 11 102437834 missense probably benign 0.04
R7754:Fam171a2 UTSW 11 102438563 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGCCTGAGGTGATGGTAACC -3'
(R):5'- CTGCTAACAGGCAATGGGAC -3'

Sequencing Primer
(F):5'- TGATGGTAACCAGCCCTGTG -3'
(R):5'- TCCAGCCTGGAGGTTTGAC -3'
Posted On2019-10-07