Incidental Mutation 'R7454:Btnl4'
ID578034
Institutional Source Beutler Lab
Gene Symbol Btnl4
Ensembl Gene ENSMUSG00000058435
Gene Namebutyrophilin-like 4
SynonymsBtnl4, EG632126, NG11
Accession Numbers

Genbank: NM_001039241; MGI: 1932036

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7454 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34469042-34475937 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34472374 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 312 (V312E)
Ref Sequence ENSEMBL: ENSMUSP00000064161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065841]
Predicted Effect probably benign
Transcript: ENSMUST00000065841
AA Change: V312E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064161
Gene: ENSMUSG00000058435
AA Change: V312E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 145 2.44e-7 SMART
Pfam:C2-set_2 150 233 3.6e-6 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 316 328 N/A INTRINSIC
PRY 341 386 7.43e-2 SMART
SPRY 387 510 4.67e-20 SMART
low complexity region 514 554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,836,851 E57G possibly damaging Het
4932414N04Rik C A 2: 68,688,304 T159K unknown Het
Adamts10 T A 17: 33,545,005 F616L possibly damaging Het
Adtrp G A 13: 41,828,315 S26L unknown Het
Alpk3 A C 7: 81,078,562 E480A probably benign Het
Anks6 T C 4: 47,038,919 T529A unknown Het
Arl4d A G 11: 101,666,660 H4R probably benign Het
Ash1l A G 3: 88,983,865 H1017R probably benign Het
Bbs12 T C 3: 37,320,953 S517P possibly damaging Het
Bcl11b C A 12: 107,916,208 R616L possibly damaging Het
Bean1 G A 8: 104,211,026 G79D probably damaging Het
Bicra C G 7: 15,972,134 G1461R probably benign Het
Bptf T C 11: 107,044,640 T124A probably benign Het
Ccdc7a A G 8: 128,944,516 M503T unknown Het
Celf5 T C 10: 81,482,523 E28G probably damaging Het
Cilp2 G A 8: 69,883,390 L350F probably damaging Het
Clec4a2 T C 6: 123,142,452 I245T probably damaging Het
Ctnnal1 A T 4: 56,844,544 V140D probably damaging Het
Dennd4a A C 9: 64,852,570 H319P probably damaging Het
Dlgap3 G T 4: 127,235,059 L857F probably null Het
Dnah6 T A 6: 73,212,492 T58S probably damaging Het
Dnah7a T A 1: 53,518,764 M2164L probably benign Het
Dspp T A 5: 104,175,610 H206Q probably benign Het
Dzip1l G A 9: 99,659,674 V443M possibly damaging Het
Erc2 A G 14: 28,302,991 H939R possibly damaging Het
Fam149a G T 8: 45,348,546 H513N probably benign Het
Fam171a2 T C 11: 102,439,717 T280A possibly damaging Het
Fam208b A G 13: 3,585,332 S492P probably benign Het
Fkbp5 A C 17: 28,416,025 V170G probably damaging Het
Fnbp4 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC 2: 90,777,815 probably benign Het
Fnbp4 ACC ACCCCCCCC 2: 90,777,818 probably benign Het
Fzd2 T C 11: 102,605,129 F133S probably damaging Het
Galm A G 17: 80,138,121 N100S possibly damaging Het
Gbp2b T A 3: 142,598,159 I5N possibly damaging Het
Gga2 T C 7: 122,002,146 R245G probably benign Het
Gm10053 A G 19: 24,875,900 T50A probably benign Het
Gm1110 T C 9: 26,920,649 T69A probably benign Het
Gm15922 T G 7: 3,735,510 E622D probably benign Het
Heatr5a T C 12: 51,961,543 S6G probably benign Het
Hmcn1 A G 1: 150,563,604 S5610P probably damaging Het
Hmgb4 A G 4: 128,260,406 V123A probably damaging Het
Itgal C A 7: 127,327,764 Q943K probably benign Het
Jakmip1 C A 5: 37,175,154 D1059E probably damaging Het
Kat6a A G 8: 22,935,772 E1111G possibly damaging Het
Kdm4b C A 17: 56,389,639 P452T probably benign Het
Krit1 T C 5: 3,812,474 Y210H probably damaging Het
Krtap6-2 A T 16: 89,419,912 Y56N unknown Het
Lig1 A T 7: 13,288,721 D158V probably damaging Het
Lmo1 A T 7: 109,140,666 L94Q probably benign Het
Lrrc30 A T 17: 67,632,243 L114H probably damaging Het
Ltn1 T C 16: 87,397,812 I1400V probably benign Het
Mark3 T C 12: 111,604,527 I87T probably damaging Het
Mfrp G T 9: 44,105,183 V392F possibly damaging Het
Mrgprg A G 7: 143,765,135 L80P probably damaging Het
Ndufaf3 A T 9: 108,566,926 M1K probably null Het
Nme7 T A 1: 164,380,648 L295* probably null Het
Noct G T 3: 51,249,730 C163F probably damaging Het
Olfr1270 T A 2: 90,149,419 I196F possibly damaging Het
Olfr229 A G 9: 39,909,904 I34V probably benign Het
Olfr541 A T 7: 140,704,634 I128F probably damaging Het
Olfr747 T A 14: 50,680,824 Q270L possibly damaging Het
Olfr772 T A 10: 129,174,455 T189S probably damaging Het
Olfr992 T A 2: 85,399,611 K307N probably damaging Het
Per3 A G 4: 151,012,728 L780P probably benign Het
Pla2g4a T C 1: 149,872,690 M256V possibly damaging Het
Pnliprp1 A G 19: 58,741,100 K395R probably benign Het
Poc5 G T 13: 96,400,832 G242V possibly damaging Het
Ppfia4 A G 1: 134,324,135 S434P possibly damaging Het
Prss42 A G 9: 110,798,829 N110S probably benign Het
Ralgapb T A 2: 158,432,902 I241N possibly damaging Het
Rbak A C 5: 143,173,773 Y508* probably null Het
S1pr2 G T 9: 20,967,549 R328S possibly damaging Het
Sap130 T C 18: 31,650,512 M214T probably benign Het
Slc46a1 T A 11: 78,466,511 V130E probably damaging Het
Smc4 A T 3: 69,018,124 H343L probably benign Het
Tarbp1 C A 8: 126,457,677 R500L probably benign Het
Tgfbr3 A T 5: 107,215,028 H39Q probably damaging Het
Tpp2 T C 1: 43,954,659 S235P probably benign Het
Trbc2 G T 6: 41,546,829 R33M Het
Trim3 C T 7: 105,619,558 R63Q probably damaging Het
Ttc28 T C 5: 111,285,484 V2128A probably benign Het
Ttn C T 2: 76,725,818 R30281H probably damaging Het
Ttn T A 2: 76,944,139 Q2187L unknown Het
Ttyh3 T C 5: 140,629,425 S403G possibly damaging Het
Vmn2r112 A T 17: 22,603,307 D322V probably benign Het
Wdr38 C T 2: 38,998,340 probably benign Het
Xrn1 T A 9: 96,048,358 S1543R probably benign Het
Zbtb8b G A 4: 129,432,769 T201I possibly damaging Het
Other mutations in Btnl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02451:Btnl4 APN 17 34475927 missense probably benign 0.34
FR4589:Btnl4 UTSW 17 34472636 missense probably benign 0.30
N/A:Btnl4 UTSW 17 34472586 splice site probably benign
PIT4458001:Btnl4 UTSW 17 34474268 missense probably benign 0.25
R0601:Btnl4 UTSW 17 34469311 missense probably benign 0.07
R0718:Btnl4 UTSW 17 34469634 missense probably benign 0.44
R1163:Btnl4 UTSW 17 34470075 missense possibly damaging 0.65
R1823:Btnl4 UTSW 17 34475852 critical splice donor site probably null
R1954:Btnl4 UTSW 17 34472930 missense possibly damaging 0.87
R1955:Btnl4 UTSW 17 34472930 missense possibly damaging 0.87
R4649:Btnl4 UTSW 17 34472628 missense probably benign 0.12
R4651:Btnl4 UTSW 17 34472628 missense probably benign 0.12
R4681:Btnl4 UTSW 17 34470101 splice site probably null
R6081:Btnl4 UTSW 17 34474236 missense probably damaging 1.00
R6770:Btnl4 UTSW 17 34474037 missense probably benign 0.26
R6859:Btnl4 UTSW 17 34469379 missense probably damaging 1.00
R6885:Btnl4 UTSW 17 34472945 missense probably benign 0.00
R7265:Btnl4 UTSW 17 34475894 missense probably benign 0.00
R7316:Btnl4 UTSW 17 34469057 missense probably benign 0.06
X0023:Btnl4 UTSW 17 34475930 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AAGCGGTTCCAACAATGCC -3'
(R):5'- CATAGCAGTGAAGGACAGGTTC -3'

Sequencing Primer
(F):5'- GGTTCCAACAATGCCAAGAATC -3'
(R):5'- AGGACAGGTTCAGAGGCCC -3'
Posted On2019-10-07