Incidental Mutation 'R7455:Phf3'
ID578041
Institutional Source Beutler Lab
Gene Symbol Phf3
Ensembl Gene ENSMUSG00000048874
Gene NamePHD finger protein 3
SynonymsAU020177, 2310061N19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7455 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location30802339-30873921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30837158 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 118 (V118G)
Ref Sequence ENSEMBL: ENSMUSP00000085650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000188780] [ENSMUST00000191064]
Predicted Effect probably damaging
Transcript: ENSMUST00000088310
AA Change: V118G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: V118G

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186733
AA Change: V118G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: V118G

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188780
SMART Domains Protein: ENSMUSP00000140935
Gene: ENSMUSG00000048874

DomainStartEndE-ValueType
low complexity region 158 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191064
AA Change: V118G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 C T 7: 76,424,755 H646Y unknown Het
Ak5 C T 3: 152,481,572 R426H probably damaging Het
Akap9 T C 5: 3,972,792 V1207A probably benign Het
Asph A T 4: 9,531,732 probably null Het
Avpr1a T G 10: 122,449,264 C154G probably damaging Het
Boll T C 1: 55,300,103 Q283R probably benign Het
Cad C T 5: 31,074,162 P1743S probably damaging Het
Ccdc137 T G 11: 120,460,159 M129R probably damaging Het
Cdh23 A G 10: 60,306,224 I3028T possibly damaging Het
Cep68 T A 11: 20,230,571 I687F probably damaging Het
Ces2a T A 8: 104,737,522 I262N probably damaging Het
Cfap44 A G 16: 44,404,784 probably benign Het
Cfap69 T G 5: 5,625,873 H247P possibly damaging Het
Cideb T C 14: 55,754,835 T134A probably damaging Het
Cilp2 A T 8: 69,881,071 D1092E probably damaging Het
Cptp G A 4: 155,866,500 R170C probably damaging Het
Cysrt1 A G 2: 25,239,410 L30S probably benign Het
Dcc A G 18: 71,420,323 V754A probably benign Het
Fam189a1 A G 7: 64,759,413 V411A probably benign Het
Fer1l5 A T 1: 36,388,983 T453S probably benign Het
Fnbp4 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC 2: 90,777,815 probably benign Het
Frem2 C T 3: 53,572,280 probably null Het
Gm13941 A G 2: 111,094,740 F173L unknown Het
Greb1l G A 18: 10,554,915 A1654T probably damaging Het
Inpp4b T A 8: 82,071,703 I840N probably damaging Het
Kdm4b T A 17: 56,396,657 I746N probably damaging Het
Lins1 C A 7: 66,711,944 H448N probably benign Het
Ly9 A T 1: 171,593,939 Y581* probably null Het
Mark1 T A 1: 184,919,750 E186V probably damaging Het
Mcph1 T A 8: 18,631,759 V304E probably benign Het
Mical3 T C 6: 120,958,744 D1607G probably damaging Het
Mup18 A G 4: 61,673,934 V31A probably benign Het
Nectin3 A T 16: 46,496,742 C11* probably null Het
Nedd1 A T 10: 92,700,925 L172M probably benign Het
Nim1k G A 13: 119,712,459 R300W probably damaging Het
Olfr1220 G T 2: 89,097,090 P279Q probably damaging Het
Olfr143 T C 9: 38,254,254 V276A probably damaging Het
Olfr834 A G 9: 18,988,854 I289V possibly damaging Het
Oprm1 T C 10: 6,830,204 F289L probably damaging Het
Parg T C 14: 32,209,475 Y351H probably benign Het
Pik3c2g T C 6: 139,967,917 Y1014H unknown Het
Pmp22 A G 11: 63,134,513 probably null Het
Ppfibp1 T A 6: 147,016,350 F501L probably damaging Het
Rgl2 G A 17: 33,932,683 A234T probably benign Het
Rhpn2 G A 7: 35,371,244 probably null Het
Ryr3 T C 2: 112,728,866 K3058E probably damaging Het
Sbsn A T 7: 30,753,177 Q539L possibly damaging Het
Scgn G A 13: 23,966,865 R168C probably benign Het
Serpinb10 A G 1: 107,536,102 Y38C probably damaging Het
Sfmbt2 G A 2: 10,577,955 V709I probably benign Het
Slc1a2 A T 2: 102,735,954 M10L probably benign Het
Sox6 T G 7: 115,489,669 I653L probably benign Het
Tespa1 A G 10: 130,360,690 I166V probably benign Het
Tex15 T C 8: 33,576,997 Y2152H possibly damaging Het
Tlr9 A G 9: 106,224,530 N340S probably benign Het
Tmem198 G A 1: 75,479,786 R28Q unknown Het
Vmn2r7 T C 3: 64,716,593 D102G probably benign Het
Wdr93 A G 7: 79,775,519 M529V probably benign Het
Zcchc6 T C 13: 59,822,057 Y8C probably benign Het
Zfp110 A G 7: 12,848,057 H310R probably benign Het
Zfp36l2 A G 17: 84,187,147 S21P probably damaging Het
Zfp534 G A 4: 147,674,755 H486Y probably damaging Het
Zfp638 G A 6: 83,930,145 V431I probably damaging Het
Other mutations in Phf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Phf3 APN 1 30811847 missense probably damaging 0.99
IGL00704:Phf3 APN 1 30804838 missense probably benign
IGL01147:Phf3 APN 1 30804169 missense probably damaging 1.00
IGL01360:Phf3 APN 1 30808728 missense probably damaging 1.00
IGL01376:Phf3 APN 1 30830485 missense possibly damaging 0.62
IGL01396:Phf3 APN 1 30804305 nonsense probably null
IGL01830:Phf3 APN 1 30814067 nonsense probably null
IGL02108:Phf3 APN 1 30829951 missense probably damaging 1.00
IGL02156:Phf3 APN 1 30808778 missense probably damaging 1.00
IGL02576:Phf3 APN 1 30830036 missense probably benign 0.01
IGL03031:Phf3 APN 1 30804653 missense probably benign 0.00
IGL03334:Phf3 APN 1 30805729 missense probably damaging 0.99
IGL03411:Phf3 APN 1 30804401 missense probably damaging 1.00
FR4976:Phf3 UTSW 1 30805023 utr 3 prime probably benign
PIT4458001:Phf3 UTSW 1 30816541 missense probably damaging 1.00
R0037:Phf3 UTSW 1 30804918 missense probably benign 0.03
R0052:Phf3 UTSW 1 30808767 missense probably damaging 1.00
R0114:Phf3 UTSW 1 30805443 missense possibly damaging 0.87
R0123:Phf3 UTSW 1 30805065 missense probably benign 0.01
R0225:Phf3 UTSW 1 30805065 missense probably benign 0.01
R0715:Phf3 UTSW 1 30811838 missense probably damaging 1.00
R0835:Phf3 UTSW 1 30830551 missense probably benign 0.02
R0848:Phf3 UTSW 1 30863172 missense probably damaging 1.00
R1473:Phf3 UTSW 1 30805940 missense probably damaging 1.00
R1522:Phf3 UTSW 1 30805648 missense probably benign 0.05
R1549:Phf3 UTSW 1 30804842 missense probably benign 0.00
R1555:Phf3 UTSW 1 30805877 missense possibly damaging 0.86
R1780:Phf3 UTSW 1 30811942 missense probably damaging 1.00
R1789:Phf3 UTSW 1 30806206 missense probably damaging 1.00
R1875:Phf3 UTSW 1 30830623 missense possibly damaging 0.81
R1912:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R1957:Phf3 UTSW 1 30831520 missense probably damaging 1.00
R2019:Phf3 UTSW 1 30811847 missense probably damaging 0.99
R2259:Phf3 UTSW 1 30804343 missense probably benign 0.20
R2305:Phf3 UTSW 1 30805475 nonsense probably null
R2345:Phf3 UTSW 1 30805351 nonsense probably null
R2424:Phf3 UTSW 1 30806349 missense probably damaging 1.00
R2497:Phf3 UTSW 1 30830014 missense probably damaging 1.00
R2504:Phf3 UTSW 1 30810789 missense probably damaging 1.00
R3522:Phf3 UTSW 1 30805603 missense probably damaging 1.00
R3816:Phf3 UTSW 1 30805753 missense probably damaging 1.00
R4152:Phf3 UTSW 1 30831458 missense probably benign 0.13
R4403:Phf3 UTSW 1 30804409 missense probably damaging 1.00
R4658:Phf3 UTSW 1 30863088 missense probably damaging 1.00
R4663:Phf3 UTSW 1 30821215 missense probably damaging 1.00
R4669:Phf3 UTSW 1 30829946 missense probably damaging 1.00
R4706:Phf3 UTSW 1 30805606 missense probably damaging 1.00
R4757:Phf3 UTSW 1 30820827 missense probably damaging 1.00
R4766:Phf3 UTSW 1 30813939 unclassified probably benign
R4786:Phf3 UTSW 1 30816557 nonsense probably null
R5107:Phf3 UTSW 1 30831485 missense probably benign 0.03
R5155:Phf3 UTSW 1 30824376 missense possibly damaging 0.87
R5310:Phf3 UTSW 1 30803806 missense probably damaging 1.00
R5823:Phf3 UTSW 1 30804683 missense probably damaging 1.00
R5944:Phf3 UTSW 1 30820704 missense probably damaging 1.00
R5979:Phf3 UTSW 1 30805746 missense probably damaging 1.00
R6007:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R6024:Phf3 UTSW 1 30863226 missense probably damaging 1.00
R6072:Phf3 UTSW 1 30830688 missense probably benign 0.08
R6533:Phf3 UTSW 1 30806318 missense probably damaging 1.00
R6649:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6653:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6852:Phf3 UTSW 1 30804630 missense probably damaging 0.97
R6855:Phf3 UTSW 1 30820123 missense probably damaging 1.00
R6862:Phf3 UTSW 1 30813982 missense probably damaging 1.00
R6930:Phf3 UTSW 1 30811877 missense probably damaging 1.00
R7135:Phf3 UTSW 1 30831109 missense possibly damaging 0.61
R7323:Phf3 UTSW 1 30813130 missense probably benign 0.01
R7352:Phf3 UTSW 1 30804326 missense possibly damaging 0.87
R7549:Phf3 UTSW 1 30831475 missense probably benign 0.01
R7609:Phf3 UTSW 1 30805501 missense probably benign 0.05
R7720:Phf3 UTSW 1 30829857 missense probably damaging 1.00
R7745:Phf3 UTSW 1 30804224 missense probably damaging 1.00
Z1177:Phf3 UTSW 1 30804295 missense probably damaging 1.00
Z1177:Phf3 UTSW 1 30805051 missense unknown
Z1177:Phf3 UTSW 1 30811968 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACAATCAGCTGAGTGGCAGG -3'
(R):5'- ACCTCATATGTTAGCAGTAGGC -3'

Sequencing Primer
(F):5'- CTGAGTGGCAGGTAGATAGGTG -3'
(R):5'- GGTCTTGACGATATTATGGATG -3'
Posted On2019-10-07