Incidental Mutation 'R7455:Gm13941'
ID578053
Institutional Source Beutler Lab
Gene Symbol Gm13941
Ensembl Gene ENSMUSG00000079170
Gene Namepredicted gene 13941
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R7455 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111088372-111105982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111094740 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 173 (F173L)
Ref Sequence ENSEMBL: ENSMUSP00000115383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127918]
Predicted Effect unknown
Transcript: ENSMUST00000127918
AA Change: F173L
SMART Domains Protein: ENSMUSP00000115383
Gene: ENSMUSG00000079170
AA Change: F173L

DomainStartEndE-ValueType
low complexity region 225 244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 C T 7: 76,424,755 H646Y unknown Het
Ak5 C T 3: 152,481,572 R426H probably damaging Het
Akap9 T C 5: 3,972,792 V1207A probably benign Het
Asph A T 4: 9,531,732 probably null Het
Avpr1a T G 10: 122,449,264 C154G probably damaging Het
Boll T C 1: 55,300,103 Q283R probably benign Het
Cad C T 5: 31,074,162 P1743S probably damaging Het
Ccdc137 T G 11: 120,460,159 M129R probably damaging Het
Cdh23 A G 10: 60,306,224 I3028T possibly damaging Het
Cep68 T A 11: 20,230,571 I687F probably damaging Het
Ces2a T A 8: 104,737,522 I262N probably damaging Het
Cfap44 A G 16: 44,404,784 probably benign Het
Cfap69 T G 5: 5,625,873 H247P possibly damaging Het
Cideb T C 14: 55,754,835 T134A probably damaging Het
Cilp2 A T 8: 69,881,071 D1092E probably damaging Het
Cptp G A 4: 155,866,500 R170C probably damaging Het
Cysrt1 A G 2: 25,239,410 L30S probably benign Het
Dcc A G 18: 71,420,323 V754A probably benign Het
Fam189a1 A G 7: 64,759,413 V411A probably benign Het
Fer1l5 A T 1: 36,388,983 T453S probably benign Het
Fnbp4 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC 2: 90,777,815 probably benign Het
Frem2 C T 3: 53,572,280 probably null Het
Greb1l G A 18: 10,554,915 A1654T probably damaging Het
Inpp4b T A 8: 82,071,703 I840N probably damaging Het
Kdm4b T A 17: 56,396,657 I746N probably damaging Het
Lins1 C A 7: 66,711,944 H448N probably benign Het
Ly9 A T 1: 171,593,939 Y581* probably null Het
Mark1 T A 1: 184,919,750 E186V probably damaging Het
Mcph1 T A 8: 18,631,759 V304E probably benign Het
Mical3 T C 6: 120,958,744 D1607G probably damaging Het
Mup18 A G 4: 61,673,934 V31A probably benign Het
Nectin3 A T 16: 46,496,742 C11* probably null Het
Nedd1 A T 10: 92,700,925 L172M probably benign Het
Nim1k G A 13: 119,712,459 R300W probably damaging Het
Olfr1220 G T 2: 89,097,090 P279Q probably damaging Het
Olfr143 T C 9: 38,254,254 V276A probably damaging Het
Olfr834 A G 9: 18,988,854 I289V possibly damaging Het
Oprm1 T C 10: 6,830,204 F289L probably damaging Het
Parg T C 14: 32,209,475 Y351H probably benign Het
Phf3 A C 1: 30,837,158 V118G probably damaging Het
Pik3c2g T C 6: 139,967,917 Y1014H unknown Het
Pmp22 A G 11: 63,134,513 probably null Het
Ppfibp1 T A 6: 147,016,350 F501L probably damaging Het
Rgl2 G A 17: 33,932,683 A234T probably benign Het
Rhpn2 G A 7: 35,371,244 probably null Het
Ryr3 T C 2: 112,728,866 K3058E probably damaging Het
Sbsn A T 7: 30,753,177 Q539L possibly damaging Het
Scgn G A 13: 23,966,865 R168C probably benign Het
Serpinb10 A G 1: 107,536,102 Y38C probably damaging Het
Sfmbt2 G A 2: 10,577,955 V709I probably benign Het
Slc1a2 A T 2: 102,735,954 M10L probably benign Het
Sox6 T G 7: 115,489,669 I653L probably benign Het
Tespa1 A G 10: 130,360,690 I166V probably benign Het
Tex15 T C 8: 33,576,997 Y2152H possibly damaging Het
Tlr9 A G 9: 106,224,530 N340S probably benign Het
Tmem198 G A 1: 75,479,786 R28Q unknown Het
Vmn2r7 T C 3: 64,716,593 D102G probably benign Het
Wdr93 A G 7: 79,775,519 M529V probably benign Het
Zcchc6 T C 13: 59,822,057 Y8C probably benign Het
Zfp110 A G 7: 12,848,057 H310R probably benign Het
Zfp36l2 A G 17: 84,187,147 S21P probably damaging Het
Zfp534 G A 4: 147,674,755 H486Y probably damaging Het
Zfp638 G A 6: 83,930,145 V431I probably damaging Het
Other mutations in Gm13941
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Gm13941 APN 2 111104853 missense unknown
IGL00420:Gm13941 APN 2 111091848 splice site probably benign
IGL01149:Gm13941 APN 2 111101137 missense unknown
IGL01319:Gm13941 APN 2 111094805 critical splice acceptor site probably null
IGL02557:Gm13941 APN 2 111101156 missense unknown
IGL03163:Gm13941 APN 2 111098416 missense unknown
R0067:Gm13941 UTSW 2 111059416 unclassified noncoding transcript
R0918:Gm13941 UTSW 2 111100600 missense unknown
R2315:Gm13941 UTSW 2 111104817 missense unknown
R3847:Gm13941 UTSW 2 111104853 missense unknown
R3848:Gm13941 UTSW 2 111104853 missense unknown
R5416:Gm13941 UTSW 2 111094734 missense unknown
R5574:Gm13941 UTSW 2 111100606 missense unknown
R6389:Gm13941 UTSW 2 111098389 missense unknown
R6616:Gm13941 UTSW 2 111101175 missense unknown
R7056:Gm13941 UTSW 2 111096802 missense unknown
Z1177:Gm13941 UTSW 2 111094778 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTTCCTTAGACATCACTCAAACTGAC -3'
(R):5'- ACAAGAAATGTGCTCCATGTGAG -3'

Sequencing Primer
(F):5'- GACATCACTCAAACTGACATCTTTG -3'
(R):5'- CCGAATTTGTTGCTTCGA -3'
Posted On2019-10-07