Incidental Mutation 'R7455:Ces2a'
ID 578078
Institutional Source Beutler Lab
Gene Symbol Ces2a
Ensembl Gene ENSMUSG00000055730
Gene Name carboxylesterase 2A
Synonyms 9130231C15Rik, Ces6
MMRRC Submission 045529-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R7455 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 105460635-105468266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105464154 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 262 (I262N)
Ref Sequence ENSEMBL: ENSMUSP00000034346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034346] [ENSMUST00000161824] [ENSMUST00000164182]
AlphaFold Q8QZR3
Predicted Effect probably damaging
Transcript: ENSMUST00000034346
AA Change: I262N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034346
Gene: ENSMUSG00000055730
AA Change: I262N

DomainStartEndE-ValueType
Pfam:COesterase 9 537 1.2e-171 PFAM
Pfam:Abhydrolase_3 142 267 2.9e-11 PFAM
Pfam:Peptidase_S9 156 347 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159303
Predicted Effect probably benign
Transcript: ENSMUST00000161824
Predicted Effect probably damaging
Transcript: ENSMUST00000164182
AA Change: I262N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127346
Gene: ENSMUSG00000055730
AA Change: I262N

DomainStartEndE-ValueType
Pfam:COesterase 8 276 5e-110 PFAM
Pfam:Abhydrolase_3 142 267 2.6e-11 PFAM
Pfam:Peptidase_S9 156 275 3e-7 PFAM
Pfam:COesterase 259 504 8.3e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 C T 7: 76,074,503 (GRCm39) H646Y unknown Het
Ak5 C T 3: 152,187,209 (GRCm39) R426H probably damaging Het
Akap9 T C 5: 4,022,792 (GRCm39) V1207A probably benign Het
Asph A T 4: 9,531,732 (GRCm39) probably null Het
Avpr1a T G 10: 122,285,169 (GRCm39) C154G probably damaging Het
Boll T C 1: 55,339,262 (GRCm39) Q283R probably benign Het
Cad C T 5: 31,231,506 (GRCm39) P1743S probably damaging Het
Ccdc137 T G 11: 120,350,985 (GRCm39) M129R probably damaging Het
Cdh23 A G 10: 60,142,003 (GRCm39) I3028T possibly damaging Het
Cep68 T A 11: 20,180,571 (GRCm39) I687F probably damaging Het
Cfap44 A G 16: 44,225,147 (GRCm39) probably benign Het
Cfap69 T G 5: 5,675,873 (GRCm39) H247P possibly damaging Het
Cideb T C 14: 55,992,292 (GRCm39) T134A probably damaging Het
Cilp2 A T 8: 70,333,721 (GRCm39) D1092E probably damaging Het
Cptp G A 4: 155,950,957 (GRCm39) R170C probably damaging Het
Cysrt1 A G 2: 25,129,422 (GRCm39) L30S probably benign Het
Dcc A G 18: 71,553,394 (GRCm39) V754A probably benign Het
Entrep2 A G 7: 64,409,161 (GRCm39) V411A probably benign Het
Fer1l5 A T 1: 36,428,064 (GRCm39) T453S probably benign Het
Fnbp4 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC 2: 90,608,159 (GRCm39) probably benign Het
Frem2 C T 3: 53,479,701 (GRCm39) probably null Het
Gm13941 A G 2: 110,925,085 (GRCm39) F173L unknown Het
Greb1l G A 18: 10,554,915 (GRCm39) A1654T probably damaging Het
Inpp4b T A 8: 82,798,332 (GRCm39) I840N probably damaging Het
Kdm4b T A 17: 56,703,657 (GRCm39) I746N probably damaging Het
Lins1 C A 7: 66,361,692 (GRCm39) H448N probably benign Het
Ly9 A T 1: 171,421,507 (GRCm39) Y581* probably null Het
Mark1 T A 1: 184,651,947 (GRCm39) E186V probably damaging Het
Mcph1 T A 8: 18,681,775 (GRCm39) V304E probably benign Het
Mical3 T C 6: 120,935,705 (GRCm39) D1607G probably damaging Het
Mup18 A G 4: 61,592,171 (GRCm39) V31A probably benign Het
Nectin3 A T 16: 46,317,105 (GRCm39) C11* probably null Het
Nedd1 A T 10: 92,536,787 (GRCm39) L172M probably benign Het
Nim1k G A 13: 120,173,995 (GRCm39) R300W probably damaging Het
Oprm1 T C 10: 6,780,204 (GRCm39) F289L probably damaging Het
Or4c115 G T 2: 88,927,434 (GRCm39) P279Q probably damaging Het
Or7g12 A G 9: 18,900,150 (GRCm39) I289V possibly damaging Het
Or8c8 T C 9: 38,165,550 (GRCm39) V276A probably damaging Het
Parg T C 14: 31,931,432 (GRCm39) Y351H probably benign Het
Phf3 A C 1: 30,876,239 (GRCm39) V118G probably damaging Het
Pik3c2g T C 6: 139,913,643 (GRCm39) Y1014H unknown Het
Pmp22 A G 11: 63,025,339 (GRCm39) probably null Het
Ppfibp1 T A 6: 146,917,848 (GRCm39) F501L probably damaging Het
Rgl2 G A 17: 34,151,657 (GRCm39) A234T probably benign Het
Rhpn2 G A 7: 35,070,669 (GRCm39) probably null Het
Ryr3 T C 2: 112,559,211 (GRCm39) K3058E probably damaging Het
Sbsn A T 7: 30,452,602 (GRCm39) Q539L possibly damaging Het
Scgn G A 13: 24,150,848 (GRCm39) R168C probably benign Het
Serpinb10 A G 1: 107,463,832 (GRCm39) Y38C probably damaging Het
Sfmbt2 G A 2: 10,582,766 (GRCm39) V709I probably benign Het
Slc1a2 A T 2: 102,566,299 (GRCm39) M10L probably benign Het
Sox6 T G 7: 115,088,904 (GRCm39) I653L probably benign Het
Tespa1 A G 10: 130,196,559 (GRCm39) I166V probably benign Het
Tex15 T C 8: 34,067,025 (GRCm39) Y2152H possibly damaging Het
Tlr9 A G 9: 106,101,729 (GRCm39) N340S probably benign Het
Tmem198 G A 1: 75,456,430 (GRCm39) R28Q unknown Het
Tut7 T C 13: 59,969,871 (GRCm39) Y8C probably benign Het
Vmn2r7 T C 3: 64,624,014 (GRCm39) D102G probably benign Het
Wdr93 A G 7: 79,425,267 (GRCm39) M529V probably benign Het
Zfp110 A G 7: 12,581,984 (GRCm39) H310R probably benign Het
Zfp36l2 A G 17: 84,494,575 (GRCm39) S21P probably damaging Het
Zfp534 G A 4: 147,759,212 (GRCm39) H486Y probably damaging Het
Zfp638 G A 6: 83,907,127 (GRCm39) V431I probably damaging Het
Other mutations in Ces2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ces2a APN 8 105,468,047 (GRCm39) makesense probably null
IGL02135:Ces2a APN 8 105,466,813 (GRCm39) missense probably benign 0.00
IGL02529:Ces2a APN 8 105,463,851 (GRCm39) splice site probably benign
IGL02625:Ces2a APN 8 105,466,910 (GRCm39) critical splice donor site probably null
IGL02869:Ces2a APN 8 105,465,691 (GRCm39) missense probably damaging 1.00
IGL03265:Ces2a APN 8 105,464,075 (GRCm39) missense possibly damaging 0.55
IGL03349:Ces2a APN 8 105,460,712 (GRCm39) missense probably damaging 0.99
R0010:Ces2a UTSW 8 105,468,028 (GRCm39) missense probably benign 0.00
R0318:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 1.00
R0477:Ces2a UTSW 8 105,464,169 (GRCm39) missense probably damaging 0.99
R0561:Ces2a UTSW 8 105,464,165 (GRCm39) missense probably benign 0.35
R0619:Ces2a UTSW 8 105,462,742 (GRCm39) missense probably benign 0.00
R1665:Ces2a UTSW 8 105,464,187 (GRCm39) splice site probably benign
R1737:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 0.98
R2266:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2267:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2269:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2288:Ces2a UTSW 8 105,464,069 (GRCm39) missense probably damaging 1.00
R2656:Ces2a UTSW 8 105,462,766 (GRCm39) missense probably benign 0.00
R3176:Ces2a UTSW 8 105,466,010 (GRCm39) splice site probably benign
R3906:Ces2a UTSW 8 105,465,940 (GRCm39) missense probably benign 0.00
R4344:Ces2a UTSW 8 105,463,766 (GRCm39) missense probably damaging 1.00
R4708:Ces2a UTSW 8 105,463,938 (GRCm39) missense probably benign 0.14
R4780:Ces2a UTSW 8 105,463,840 (GRCm39) missense probably damaging 1.00
R5434:Ces2a UTSW 8 105,464,041 (GRCm39) missense probably damaging 0.98
R5763:Ces2a UTSW 8 105,462,756 (GRCm39) missense probably benign 0.00
R5828:Ces2a UTSW 8 105,465,956 (GRCm39) missense probably benign 0.00
R6359:Ces2a UTSW 8 105,462,710 (GRCm39) missense probably benign 0.00
R6440:Ces2a UTSW 8 105,467,954 (GRCm39) missense probably benign 0.12
R7066:Ces2a UTSW 8 105,466,880 (GRCm39) missense probably damaging 0.99
R7267:Ces2a UTSW 8 105,465,672 (GRCm39) missense probably benign 0.20
R7395:Ces2a UTSW 8 105,466,273 (GRCm39) missense probably benign 0.35
R7457:Ces2a UTSW 8 105,464,021 (GRCm39) missense possibly damaging 0.87
R7567:Ces2a UTSW 8 105,467,930 (GRCm39) missense probably benign 0.01
R7683:Ces2a UTSW 8 105,463,744 (GRCm39) missense probably benign 0.00
R8328:Ces2a UTSW 8 105,463,998 (GRCm39) missense probably damaging 1.00
R8336:Ces2a UTSW 8 105,465,665 (GRCm39) missense probably damaging 0.97
R9183:Ces2a UTSW 8 105,460,774 (GRCm39) missense possibly damaging 0.95
R9794:Ces2a UTSW 8 105,467,896 (GRCm39) missense probably benign 0.16
X0022:Ces2a UTSW 8 105,462,774 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,461,482 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,460,638 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGGGCAGCCACACTTTCTTC -3'
(R):5'- TGCTAAGGACAGAAGCCAC -3'

Sequencing Primer
(F):5'- ATACCTGGACCAAGTGGCTG -3'
(R):5'- CCACTGGAGAGAGGTTTGC -3'
Posted On 2019-10-07