Incidental Mutation 'R7455:Greb1l'
ID578098
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7455 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10554915 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1654 (A1654T)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977]
Predicted Effect probably damaging
Transcript: ENSMUST00000048977
AA Change: A1654T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: A1654T

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 C T 7: 76,424,755 H646Y unknown Het
Ak5 C T 3: 152,481,572 R426H probably damaging Het
Akap9 T C 5: 3,972,792 V1207A probably benign Het
Asph A T 4: 9,531,732 probably null Het
Avpr1a T G 10: 122,449,264 C154G probably damaging Het
Boll T C 1: 55,300,103 Q283R probably benign Het
Cad C T 5: 31,074,162 P1743S probably damaging Het
Ccdc137 T G 11: 120,460,159 M129R probably damaging Het
Cdh23 A G 10: 60,306,224 I3028T possibly damaging Het
Cep68 T A 11: 20,230,571 I687F probably damaging Het
Ces2a T A 8: 104,737,522 I262N probably damaging Het
Cfap44 A G 16: 44,404,784 probably benign Het
Cfap69 T G 5: 5,625,873 H247P possibly damaging Het
Cideb T C 14: 55,754,835 T134A probably damaging Het
Cilp2 A T 8: 69,881,071 D1092E probably damaging Het
Cptp G A 4: 155,866,500 R170C probably damaging Het
Cysrt1 A G 2: 25,239,410 L30S probably benign Het
Dcc A G 18: 71,420,323 V754A probably benign Het
Fam189a1 A G 7: 64,759,413 V411A probably benign Het
Fer1l5 A T 1: 36,388,983 T453S probably benign Het
Fnbp4 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC 2: 90,777,815 probably benign Het
Frem2 C T 3: 53,572,280 probably null Het
Gm13941 A G 2: 111,094,740 F173L unknown Het
Inpp4b T A 8: 82,071,703 I840N probably damaging Het
Kdm4b T A 17: 56,396,657 I746N probably damaging Het
Lins1 C A 7: 66,711,944 H448N probably benign Het
Ly9 A T 1: 171,593,939 Y581* probably null Het
Mark1 T A 1: 184,919,750 E186V probably damaging Het
Mcph1 T A 8: 18,631,759 V304E probably benign Het
Mical3 T C 6: 120,958,744 D1607G probably damaging Het
Mup18 A G 4: 61,673,934 V31A probably benign Het
Nectin3 A T 16: 46,496,742 C11* probably null Het
Nedd1 A T 10: 92,700,925 L172M probably benign Het
Nim1k G A 13: 119,712,459 R300W probably damaging Het
Olfr1220 G T 2: 89,097,090 P279Q probably damaging Het
Olfr143 T C 9: 38,254,254 V276A probably damaging Het
Olfr834 A G 9: 18,988,854 I289V possibly damaging Het
Oprm1 T C 10: 6,830,204 F289L probably damaging Het
Parg T C 14: 32,209,475 Y351H probably benign Het
Phf3 A C 1: 30,837,158 V118G probably damaging Het
Pik3c2g T C 6: 139,967,917 Y1014H unknown Het
Pmp22 A G 11: 63,134,513 probably null Het
Ppfibp1 T A 6: 147,016,350 F501L probably damaging Het
Rgl2 G A 17: 33,932,683 A234T probably benign Het
Rhpn2 G A 7: 35,371,244 probably null Het
Ryr3 T C 2: 112,728,866 K3058E probably damaging Het
Sbsn A T 7: 30,753,177 Q539L possibly damaging Het
Scgn G A 13: 23,966,865 R168C probably benign Het
Serpinb10 A G 1: 107,536,102 Y38C probably damaging Het
Sfmbt2 G A 2: 10,577,955 V709I probably benign Het
Slc1a2 A T 2: 102,735,954 M10L probably benign Het
Sox6 T G 7: 115,489,669 I653L probably benign Het
Tespa1 A G 10: 130,360,690 I166V probably benign Het
Tex15 T C 8: 33,576,997 Y2152H possibly damaging Het
Tlr9 A G 9: 106,224,530 N340S probably benign Het
Tmem198 G A 1: 75,479,786 R28Q unknown Het
Vmn2r7 T C 3: 64,716,593 D102G probably benign Het
Wdr93 A G 7: 79,775,519 M529V probably benign Het
Zcchc6 T C 13: 59,822,057 Y8C probably benign Het
Zfp110 A G 7: 12,848,057 H310R probably benign Het
Zfp36l2 A G 17: 84,187,147 S21P probably damaging Het
Zfp534 G A 4: 147,674,755 H486Y probably damaging Het
Zfp638 G A 6: 83,930,145 V431I probably damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCTCATGACAGTCAGC -3'
(R):5'- GGCAATACCCTCTGATAGATAGCAG -3'

Sequencing Primer
(F):5'- AGCATGACTGGACTTTGTAAATTATC -3'
(R):5'- TACCCTCTGATAGATAGCAGGATGAC -3'
Posted On2019-10-07