Incidental Mutation 'R7455:Dcc'
ID578099
Institutional Source Beutler Lab
Gene Symbol Dcc
Ensembl Gene ENSMUSG00000060534
Gene Namedeleted in colorectal carcinoma
SynonymsC030036D22Rik, Igdcc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7455 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location71258738-72351069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71420323 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 754 (V754A)
Ref Sequence ENSEMBL: ENSMUSP00000110593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073379] [ENSMUST00000114943]
Predicted Effect probably benign
Transcript: ENSMUST00000073379
AA Change: V754A

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073094
Gene: ENSMUSG00000060534
AA Change: V754A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 824 909 2.48e-6 SMART
FN3 925 1011 1.35e-7 SMART
transmembrane domain 1079 1101 N/A INTRINSIC
Pfam:Neogenin_C 1126 1425 5.5e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114943
AA Change: V754A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110593
Gene: ENSMUSG00000060534
AA Change: V754A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 844 929 2.48e-6 SMART
FN3 945 1031 1.35e-7 SMART
transmembrane domain 1099 1121 N/A INTRINSIC
Pfam:Neogenin_C 1148 1445 3.4e-113 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a netrin 1 receptor. The transmembrane protein is a member of the immunoglobulin superfamily of cell adhesion molecules, and mediates axon guidance of neuronal growth cones towards sources of netrin 1 ligand. The cytoplasmic tail interacts with the tyrosine kinases Src and focal adhesion kinase (FAK, also known as PTK2) to mediate axon attraction. The protein partially localizes to lipid rafts, and induces apoptosis in the absence of ligand. The protein functions as a tumor suppressor, and is frequently mutated or downregulated in colorectal cancer and esophageal carcinoma. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous animals show defects in axonal projections and hypothalamic development affecting both visual and neruoendocrine systems. Incidence of tumors increases in mutations preventing netrin-1 binding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 C T 7: 76,424,755 H646Y unknown Het
Ak5 C T 3: 152,481,572 R426H probably damaging Het
Akap9 T C 5: 3,972,792 V1207A probably benign Het
Asph A T 4: 9,531,732 probably null Het
Avpr1a T G 10: 122,449,264 C154G probably damaging Het
Boll T C 1: 55,300,103 Q283R probably benign Het
Cad C T 5: 31,074,162 P1743S probably damaging Het
Ccdc137 T G 11: 120,460,159 M129R probably damaging Het
Cdh23 A G 10: 60,306,224 I3028T possibly damaging Het
Cep68 T A 11: 20,230,571 I687F probably damaging Het
Ces2a T A 8: 104,737,522 I262N probably damaging Het
Cfap44 A G 16: 44,404,784 probably benign Het
Cfap69 T G 5: 5,625,873 H247P possibly damaging Het
Cideb T C 14: 55,754,835 T134A probably damaging Het
Cilp2 A T 8: 69,881,071 D1092E probably damaging Het
Cptp G A 4: 155,866,500 R170C probably damaging Het
Cysrt1 A G 2: 25,239,410 L30S probably benign Het
Fam189a1 A G 7: 64,759,413 V411A probably benign Het
Fer1l5 A T 1: 36,388,983 T453S probably benign Het
Fnbp4 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC 2: 90,777,815 probably benign Het
Frem2 C T 3: 53,572,280 probably null Het
Gm13941 A G 2: 111,094,740 F173L unknown Het
Greb1l G A 18: 10,554,915 A1654T probably damaging Het
Inpp4b T A 8: 82,071,703 I840N probably damaging Het
Kdm4b T A 17: 56,396,657 I746N probably damaging Het
Lins1 C A 7: 66,711,944 H448N probably benign Het
Ly9 A T 1: 171,593,939 Y581* probably null Het
Mark1 T A 1: 184,919,750 E186V probably damaging Het
Mcph1 T A 8: 18,631,759 V304E probably benign Het
Mical3 T C 6: 120,958,744 D1607G probably damaging Het
Mup18 A G 4: 61,673,934 V31A probably benign Het
Nectin3 A T 16: 46,496,742 C11* probably null Het
Nedd1 A T 10: 92,700,925 L172M probably benign Het
Nim1k G A 13: 119,712,459 R300W probably damaging Het
Olfr1220 G T 2: 89,097,090 P279Q probably damaging Het
Olfr143 T C 9: 38,254,254 V276A probably damaging Het
Olfr834 A G 9: 18,988,854 I289V possibly damaging Het
Oprm1 T C 10: 6,830,204 F289L probably damaging Het
Parg T C 14: 32,209,475 Y351H probably benign Het
Phf3 A C 1: 30,837,158 V118G probably damaging Het
Pik3c2g T C 6: 139,967,917 Y1014H unknown Het
Pmp22 A G 11: 63,134,513 probably null Het
Ppfibp1 T A 6: 147,016,350 F501L probably damaging Het
Rgl2 G A 17: 33,932,683 A234T probably benign Het
Rhpn2 G A 7: 35,371,244 probably null Het
Ryr3 T C 2: 112,728,866 K3058E probably damaging Het
Sbsn A T 7: 30,753,177 Q539L possibly damaging Het
Scgn G A 13: 23,966,865 R168C probably benign Het
Serpinb10 A G 1: 107,536,102 Y38C probably damaging Het
Sfmbt2 G A 2: 10,577,955 V709I probably benign Het
Slc1a2 A T 2: 102,735,954 M10L probably benign Het
Sox6 T G 7: 115,489,669 I653L probably benign Het
Tespa1 A G 10: 130,360,690 I166V probably benign Het
Tex15 T C 8: 33,576,997 Y2152H possibly damaging Het
Tlr9 A G 9: 106,224,530 N340S probably benign Het
Tmem198 G A 1: 75,479,786 R28Q unknown Het
Vmn2r7 T C 3: 64,716,593 D102G probably benign Het
Wdr93 A G 7: 79,775,519 M529V probably benign Het
Zcchc6 T C 13: 59,822,057 Y8C probably benign Het
Zfp110 A G 7: 12,848,057 H310R probably benign Het
Zfp36l2 A G 17: 84,187,147 S21P probably damaging Het
Zfp534 G A 4: 147,674,755 H486Y probably damaging Het
Zfp638 G A 6: 83,930,145 V431I probably damaging Het
Other mutations in Dcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dcc APN 18 71384225 critical splice acceptor site probably null
IGL00781:Dcc APN 18 71809195 missense probably benign 0.25
IGL00818:Dcc APN 18 71955012 missense probably benign
IGL00895:Dcc APN 18 71810800 missense probably damaging 0.98
IGL00969:Dcc APN 18 71456883 missense probably benign 0.25
IGL01019:Dcc APN 18 71809090 missense probably benign 0.00
IGL01132:Dcc APN 18 71682174 nonsense probably null
IGL01349:Dcc APN 18 71370737 missense probably damaging 1.00
IGL01355:Dcc APN 18 71809114 missense probably benign 0.00
IGL01374:Dcc APN 18 71374553 missense probably damaging 1.00
IGL01947:Dcc APN 18 71826209 missense probably benign
IGL02470:Dcc APN 18 71955082 splice site probably benign
IGL02508:Dcc APN 18 71370702 missense probably benign 0.00
IGL02999:Dcc APN 18 71378678 missense possibly damaging 0.68
IGL03034:Dcc APN 18 71575143 nonsense probably null
IGL03118:Dcc APN 18 71420273 missense probably benign 0.00
IGL03133:Dcc APN 18 71262955 splice site probably benign
IGL03357:Dcc APN 18 71327554 missense probably damaging 1.00
Hyperrev UTSW 18 71259015 missense probably damaging 1.00
LCD18:Dcc UTSW 18 72297447 intron probably benign
P0031:Dcc UTSW 18 71384228 splice site probably benign
PIT4142001:Dcc UTSW 18 71384226 splice site probably null
R0076:Dcc UTSW 18 71321046 nonsense probably null
R0355:Dcc UTSW 18 71575208 missense possibly damaging 0.75
R0370:Dcc UTSW 18 71587985 missense possibly damaging 0.92
R0383:Dcc UTSW 18 71420263 missense probably damaging 0.99
R0541:Dcc UTSW 18 71259015 missense probably damaging 1.00
R0690:Dcc UTSW 18 71809204 splice site probably benign
R0762:Dcc UTSW 18 71342705 splice site probably benign
R0765:Dcc UTSW 18 71362990 missense probably damaging 1.00
R0846:Dcc UTSW 18 71826212 missense probably benign 0.06
R1230:Dcc UTSW 18 71682313 missense probably damaging 1.00
R1662:Dcc UTSW 18 71420338 missense probably benign 0.00
R1663:Dcc UTSW 18 71826052 missense probably damaging 1.00
R1697:Dcc UTSW 18 71370737 missense probably damaging 1.00
R1770:Dcc UTSW 18 71446399 missense probably benign 0.01
R1781:Dcc UTSW 18 71378717 missense probably benign 0.41
R1797:Dcc UTSW 18 71367161 missense probably damaging 1.00
R2101:Dcc UTSW 18 71810870 missense possibly damaging 0.62
R2190:Dcc UTSW 18 71547420 missense possibly damaging 0.89
R2248:Dcc UTSW 18 71826168 missense probably benign 0.00
R2262:Dcc UTSW 18 71374551 missense probably damaging 1.00
R2442:Dcc UTSW 18 71456883 missense probably damaging 0.98
R3844:Dcc UTSW 18 71826186 missense probably benign 0.01
R4037:Dcc UTSW 18 72350397 missense possibly damaging 0.57
R4085:Dcc UTSW 18 71826169 missense probably benign 0.00
R4344:Dcc UTSW 18 71374490 missense probably damaging 0.99
R4499:Dcc UTSW 18 71547317 missense probably benign 0.07
R4611:Dcc UTSW 18 71548998 splice site probably null
R4811:Dcc UTSW 18 71299483 missense probably benign 0.31
R4937:Dcc UTSW 18 71542249 nonsense probably null
R5125:Dcc UTSW 18 71456877 missense probably benign 0.02
R5292:Dcc UTSW 18 71306088 missense probably damaging 1.00
R5297:Dcc UTSW 18 71378738 missense probably benign 0.00
R5317:Dcc UTSW 18 71384155 missense possibly damaging 0.78
R5691:Dcc UTSW 18 71575083 missense probably damaging 1.00
R5693:Dcc UTSW 18 71575082 missense probably damaging 1.00
R6091:Dcc UTSW 18 71809114 missense probably benign 0.00
R6291:Dcc UTSW 18 71682167 missense probably benign 0.06
R6307:Dcc UTSW 18 71810755 missense probably benign 0.15
R6343:Dcc UTSW 18 71336035 missense probably damaging 1.00
R6508:Dcc UTSW 18 71306073 missense probably damaging 1.00
R6701:Dcc UTSW 18 71809120 missense probably benign 0.02
R6810:Dcc UTSW 18 71370693 missense probably damaging 0.99
R7078:Dcc UTSW 18 71547398 missense probably benign 0.05
R7172:Dcc UTSW 18 71378684 missense probably benign 0.04
R7345:Dcc UTSW 18 71378824 missense probably benign 0.00
R7365:Dcc UTSW 18 71826123 missense probably damaging 0.98
R7395:Dcc UTSW 18 71374569 nonsense probably null
R7461:Dcc UTSW 18 71306034 missense probably damaging 1.00
R7485:Dcc UTSW 18 71420246 missense probably benign 0.00
R7732:Dcc UTSW 18 71446435 missense probably benign 0.24
R7886:Dcc UTSW 18 71954868 nonsense probably null
R7969:Dcc UTSW 18 71954868 nonsense probably null
W0251:Dcc UTSW 18 71826083 missense probably damaging 1.00
X0020:Dcc UTSW 18 71321100 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCATGGTACCTGCTGAAACC -3'
(R):5'- TAGGTGCTAGGAAAGAAGTACTCTG -3'

Sequencing Primer
(F):5'- TGGTACCTGCTGAAACCATAATC -3'
(R):5'- GCTAGGAAAGAAGTACTCTGGTTAAC -3'
Posted On2019-10-07