Incidental Mutation 'R7456:Gsn'
ID578102
Institutional Source Beutler Lab
Gene Symbol Gsn
Ensembl Gene ENSMUSG00000026879
Gene Namegelsolin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.667) question?
Stock #R7456 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location35256380-35307892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35282706 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 3 (K3N)
Ref Sequence ENSEMBL: ENSMUSP00000144296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028239] [ENSMUST00000139867] [ENSMUST00000142324] [ENSMUST00000201185] [ENSMUST00000202899] [ENSMUST00000202990]
Predicted Effect probably benign
Transcript: ENSMUST00000028239
SMART Domains Protein: ENSMUSP00000028239
Gene: ENSMUSG00000026879

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
GEL 64 162 7.31e-30 SMART
GEL 183 275 1.53e-32 SMART
GEL 299 394 2.59e-30 SMART
GEL 443 540 9.28e-32 SMART
GEL 561 646 1.67e-24 SMART
GEL 666 761 4.04e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000139867
AA Change: K3N

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144217
Gene: ENSMUSG00000026879
AA Change: K3N

DomainStartEndE-ValueType
GEL 26 124 4.9e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142324
SMART Domains Protein: ENSMUSP00000118120
Gene: ENSMUSG00000026879

DomainStartEndE-ValueType
GEL 15 113 7.31e-30 SMART
GEL 134 226 1.53e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201185
SMART Domains Protein: ENSMUSP00000144561
Gene: ENSMUSG00000026879

DomainStartEndE-ValueType
GEL 15 113 4.9e-32 SMART
GEL 134 226 9.6e-35 SMART
GEL 250 345 1.6e-32 SMART
GEL 394 491 5.8e-34 SMART
GEL 512 597 1.1e-26 SMART
GEL 617 712 2.7e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202899
SMART Domains Protein: ENSMUSP00000144470
Gene: ENSMUSG00000026879

DomainStartEndE-ValueType
GEL 15 113 4.9e-32 SMART
GEL 134 226 9.6e-35 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000202990
AA Change: K3N

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144296
Gene: ENSMUSG00000026879
AA Change: K3N

DomainStartEndE-ValueType
GEL 26 124 4.9e-32 SMART
GEL 145 237 9.6e-35 SMART
GEL 261 356 1.6e-32 SMART
GEL 405 502 5.8e-34 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the "plus" ends of actin monomers and filaments to prevent monomer exchange. The encoded calcium-regulated protein functions in both assembly and disassembly of actin filaments. Defects in this gene are a cause of familial amyloidosis Finnish type (FAF). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in the immune system, platelet and platelet function, bone density, nervous and circulatory system. In addition, there are background related effects on viability and mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,442,933 L612* probably null Het
9030624J02Rik C T 7: 118,804,117 P628S probably benign Het
Acer2 A G 4: 86,874,511 D8G possibly damaging Het
Angpt4 T C 2: 151,939,067 Y412H probably damaging Het
Ankef1 A G 2: 136,545,814 D217G probably benign Het
Ano2 A T 6: 125,963,545 I544F probably benign Het
App G A 16: 85,173,560 Het
Arhgef26 A G 3: 62,340,055 T187A probably benign Het
Axin1 T A 17: 26,143,165 V161E probably damaging Het
Bbs7 A T 3: 36,594,378 V407D probably damaging Het
C1qtnf3 A T 15: 10,972,051 E141V probably benign Het
C2 A G 17: 34,864,582 I469T probably damaging Het
Cc2d1a A G 8: 84,140,239 probably null Het
Cd226 A T 18: 89,206,623 I10F probably damaging Het
Cep295nl T C 11: 118,333,550 K156R possibly damaging Het
Cfap44 A G 16: 44,431,942 T805A probably benign Het
Chd9 G T 8: 90,932,525 E38* probably null Het
Cldnd2 C T 7: 43,441,685 L14F not run Het
Cyp11b2 T C 15: 74,853,530 T247A probably benign Het
Dsc1 T C 18: 20,086,822 S764G probably benign Het
Dsg3 A T 18: 20,531,363 T473S probably benign Het
E330009J07Rik T G 6: 40,406,840 M423L probably benign Het
Fam193a A T 5: 34,420,788 I209F possibly damaging Het
Foxs1 T C 2: 152,933,125 K3E probably benign Het
Gabrr3 C T 16: 59,407,490 Q37* probably null Het
Gcm2 A T 13: 41,103,275 W333R probably benign Het
Gcn1l1 C T 5: 115,604,946 Q1559* probably null Het
Gfm2 A T 13: 97,145,703 K69* probably null Het
Gm14295 T G 2: 176,809,150 C144W possibly damaging Het
Gm32742 G A 9: 51,159,970 T5I probably damaging Het
Gm5093 T C 17: 46,439,753 D116G probably damaging Het
H2-M2 C T 17: 37,481,661 D240N possibly damaging Het
Habp2 G C 19: 56,319,525 G482R probably damaging Het
Hnrnpm A T 17: 33,646,648 Y680N possibly damaging Het
Hrc T A 7: 45,336,896 D490E possibly damaging Het
Impg2 A G 16: 56,259,913 I693M probably benign Het
Itga7 A G 10: 128,941,936 Y262C probably damaging Het
Kif1c A G 11: 70,728,598 T1020A probably benign Het
Kif23 T C 9: 61,937,120 I139V probably benign Het
Klk5 A G 7: 43,850,831 E281G probably benign Het
Kpna4 A G 3: 69,092,848 V275A probably damaging Het
Lamb2 C A 9: 108,485,780 D787E possibly damaging Het
Ldlrad3 A C 2: 101,954,925 V235G probably damaging Het
Maneal A G 4: 124,856,974 S330P probably damaging Het
Maz G A 7: 127,026,317 Q35* probably null Het
Mthfd1l C T 10: 4,089,998 T803M probably damaging Het
Muc5ac A G 7: 141,793,167 Q325R probably benign Het
Myo3a C A 2: 22,407,444 A758E probably benign Het
Ndufb7 A G 8: 83,566,853 D12G probably benign Het
Nsun2 T A 13: 69,633,606 C677S probably damaging Het
Obscn A G 11: 59,008,558 F6471S probably benign Het
Olfr1204 A T 2: 88,852,219 I90F probably damaging Het
Olfr639 A G 7: 104,011,838 V288A possibly damaging Het
Olfr851 T C 9: 19,497,548 S267P probably damaging Het
Otof T C 5: 30,394,661 D313G probably damaging Het
Paqr5 T C 9: 61,972,790 D74G probably benign Het
Pigq A G 17: 25,934,606 V365A unknown Het
Podn A T 4: 108,017,805 N588K probably benign Het
Polr3b G A 10: 84,622,491 G9R probably benign Het
Proser1 A G 3: 53,478,518 H607R probably damaging Het
Ryr2 C T 13: 11,752,282 V1241I probably benign Het
Sar1b G A 11: 51,791,354 A170T probably benign Het
Slc22a17 T C 14: 54,912,259 T191A probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,040 unknown Het
Slco6d1 A T 1: 98,421,357 D51V possibly damaging Het
Snx16 G A 3: 10,435,481 R143* probably null Het
Sytl2 T A 7: 90,348,847 L19Q probably damaging Het
Tmcc3 A G 10: 94,582,312 E345G possibly damaging Het
Ttn C T 2: 76,725,654 A30336T probably damaging Het
Vmn1r44 A G 6: 89,893,419 D49G probably benign Het
Vps41 T A 13: 18,864,034 D801E probably benign Het
Wif1 G A 10: 121,096,649 E311K probably benign Het
Zfp513 G T 5: 31,200,415 R207S possibly damaging Het
Zfp52 C A 17: 21,561,353 H488N probably damaging Het
Zfp738 A G 13: 67,669,500 Y791H probably damaging Het
Other mutations in Gsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Gsn APN 2 35284037 missense probably damaging 1.00
IGL02119:Gsn APN 2 35302495 missense probably damaging 1.00
IGL02512:Gsn APN 2 35283950 nonsense probably null
IGL02550:Gsn APN 2 35282607 intron probably benign
IGL02975:Gsn APN 2 35304654 missense probably benign 0.25
IGL03061:Gsn APN 2 35282459 intron probably benign
R0321:Gsn UTSW 2 35290396 missense probably benign 0.03
R0454:Gsn UTSW 2 35304639 missense probably damaging 1.00
R1446:Gsn UTSW 2 35306586 missense probably benign 0.04
R1760:Gsn UTSW 2 35284823 missense probably damaging 1.00
R1974:Gsn UTSW 2 35301471 missense probably damaging 1.00
R2258:Gsn UTSW 2 35290337 missense probably damaging 1.00
R2260:Gsn UTSW 2 35290337 missense probably damaging 1.00
R2281:Gsn UTSW 2 35283918 missense probably benign 0.01
R2495:Gsn UTSW 2 35303193 missense probably damaging 1.00
R2516:Gsn UTSW 2 35283953 missense probably benign
R3896:Gsn UTSW 2 35302638 missense possibly damaging 0.92
R4003:Gsn UTSW 2 35283983 missense probably benign 0.38
R4006:Gsn UTSW 2 35307621 nonsense probably null
R4281:Gsn UTSW 2 35298871 missense probably damaging 1.00
R4291:Gsn UTSW 2 35290420 missense probably benign 0.14
R4692:Gsn UTSW 2 35298871 missense probably damaging 1.00
R4850:Gsn UTSW 2 35283900 splice site probably null
R4895:Gsn UTSW 2 35302578 missense probably damaging 1.00
R5011:Gsn UTSW 2 35298921 missense probably damaging 1.00
R5013:Gsn UTSW 2 35298921 missense probably damaging 1.00
R5290:Gsn UTSW 2 35296472 missense probably benign 0.01
R6472:Gsn UTSW 2 35290451 unclassified probably null
R6764:Gsn UTSW 2 35284044 missense probably damaging 1.00
R7018:Gsn UTSW 2 35293506 missense probably benign 0.03
R7036:Gsn UTSW 2 35292599 missense probably damaging 1.00
R7097:Gsn UTSW 2 35295049 nonsense probably null
R7122:Gsn UTSW 2 35295049 nonsense probably null
R7183:Gsn UTSW 2 35294948 missense probably benign 0.00
R7203:Gsn UTSW 2 35298795 missense probably benign 0.00
R7488:Gsn UTSW 2 35296421 missense possibly damaging 0.65
R7880:Gsn UTSW 2 35283927 missense probably damaging 1.00
R7963:Gsn UTSW 2 35283927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTACTTAAAGGTTGGGGCGAC -3'
(R):5'- GGACTCTGAGAAAGACCAGC -3'

Sequencing Primer
(F):5'- TCGCCATGGCTCCGTAC -3'
(R):5'- CCAGCAAGAAGGGCAGTAGTTAG -3'
Posted On2019-10-07