Incidental Mutation 'R7456:Ankef1'
ID578106
Institutional Source Beutler Lab
Gene Symbol Ankef1
Ensembl Gene ENSMUSG00000074771
Gene Nameankyrin repeat and EF-hand domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7456 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location136501910-136562091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136545814 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 217 (D217G)
Ref Sequence ENSEMBL: ENSMUSP00000120000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028726] [ENSMUST00000121717] [ENSMUST00000123214] [ENSMUST00000149712] [ENSMUST00000180246]
Predicted Effect probably benign
Transcript: ENSMUST00000028726
AA Change: D217G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000028726
Gene: ENSMUSG00000074771
AA Change: D217G

DomainStartEndE-ValueType
ANK 47 76 6.92e-4 SMART
ANK 80 109 5.21e1 SMART
ANK 113 144 1.96e3 SMART
ANK 148 179 1.07e2 SMART
ANK 184 213 3.85e-2 SMART
ANK 217 246 3.68e1 SMART
ANK 250 279 2.28e-4 SMART
Blast:ANK 283 312 9e-6 BLAST
low complexity region 412 428 N/A INTRINSIC
ANK 524 553 1.19e-7 SMART
ANK 557 586 4.63e-5 SMART
ANK 590 619 1.54e-1 SMART
Blast:ANK 623 652 4e-10 BLAST
low complexity region 733 744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121717
AA Change: D217G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113881
Gene: ENSMUSG00000074771
AA Change: D217G

DomainStartEndE-ValueType
ANK 47 76 6.92e-4 SMART
ANK 80 109 5.21e1 SMART
ANK 113 144 1.96e3 SMART
ANK 148 179 1.07e2 SMART
ANK 184 213 3.85e-2 SMART
ANK 217 246 3.68e1 SMART
ANK 250 279 2.28e-4 SMART
Blast:ANK 283 312 9e-6 BLAST
low complexity region 412 428 N/A INTRINSIC
ANK 524 553 1.19e-7 SMART
ANK 557 586 4.63e-5 SMART
ANK 590 619 1.54e-1 SMART
Blast:ANK 623 652 4e-10 BLAST
low complexity region 733 744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123214
AA Change: D217G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000120000
Gene: ENSMUSG00000074771
AA Change: D217G

DomainStartEndE-ValueType
ANK 47 76 6.92e-4 SMART
ANK 80 109 5.21e1 SMART
ANK 113 144 1.96e3 SMART
ANK 148 179 1.07e2 SMART
ANK 184 213 3.85e-2 SMART
ANK 217 246 3.68e1 SMART
ANK 250 279 2.28e-4 SMART
Blast:ANK 283 312 4e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149712
SMART Domains Protein: ENSMUSP00000114440
Gene: ENSMUSG00000074771

DomainStartEndE-ValueType
ANK 47 76 6.92e-4 SMART
ANK 80 109 5.21e1 SMART
ANK 113 144 1.96e3 SMART
ANK 148 179 1.07e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180246
AA Change: D217G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135947
Gene: ENSMUSG00000074771
AA Change: D217G

DomainStartEndE-ValueType
ANK 47 76 6.92e-4 SMART
ANK 80 109 5.21e1 SMART
ANK 113 144 1.96e3 SMART
ANK 148 179 1.07e2 SMART
ANK 184 213 3.85e-2 SMART
ANK 217 246 3.68e1 SMART
ANK 250 279 2.28e-4 SMART
Blast:ANK 283 312 9e-6 BLAST
low complexity region 412 428 N/A INTRINSIC
ANK 524 553 1.19e-7 SMART
ANK 557 586 4.63e-5 SMART
ANK 590 619 1.54e-1 SMART
Blast:ANK 623 652 4e-10 BLAST
low complexity region 733 744 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,442,933 L612* probably null Het
9030624J02Rik C T 7: 118,804,117 P628S probably benign Het
Acer2 A G 4: 86,874,511 D8G possibly damaging Het
Angpt4 T C 2: 151,939,067 Y412H probably damaging Het
Ano2 A T 6: 125,963,545 I544F probably benign Het
App G A 16: 85,173,560 Het
Arhgef26 A G 3: 62,340,055 T187A probably benign Het
Axin1 T A 17: 26,143,165 V161E probably damaging Het
Bbs7 A T 3: 36,594,378 V407D probably damaging Het
C1qtnf3 A T 15: 10,972,051 E141V probably benign Het
C2 A G 17: 34,864,582 I469T probably damaging Het
Cc2d1a A G 8: 84,140,239 probably null Het
Cd226 A T 18: 89,206,623 I10F probably damaging Het
Cep295nl T C 11: 118,333,550 K156R possibly damaging Het
Cfap44 A G 16: 44,431,942 T805A probably benign Het
Chd9 G T 8: 90,932,525 E38* probably null Het
Cldnd2 C T 7: 43,441,685 L14F not run Het
Cyp11b2 T C 15: 74,853,530 T247A probably benign Het
Dsc1 T C 18: 20,086,822 S764G probably benign Het
Dsg3 A T 18: 20,531,363 T473S probably benign Het
E330009J07Rik T G 6: 40,406,840 M423L probably benign Het
Fam193a A T 5: 34,420,788 I209F possibly damaging Het
Foxs1 T C 2: 152,933,125 K3E probably benign Het
Gabrr3 C T 16: 59,407,490 Q37* probably null Het
Gcm2 A T 13: 41,103,275 W333R probably benign Het
Gcn1l1 C T 5: 115,604,946 Q1559* probably null Het
Gfm2 A T 13: 97,145,703 K69* probably null Het
Gm14295 T G 2: 176,809,150 C144W possibly damaging Het
Gm32742 G A 9: 51,159,970 T5I probably damaging Het
Gm5093 T C 17: 46,439,753 D116G probably damaging Het
Gsn A T 2: 35,282,706 K3N possibly damaging Het
H2-M2 C T 17: 37,481,661 D240N possibly damaging Het
Habp2 G C 19: 56,319,525 G482R probably damaging Het
Hnrnpm A T 17: 33,646,648 Y680N possibly damaging Het
Hrc T A 7: 45,336,896 D490E possibly damaging Het
Impg2 A G 16: 56,259,913 I693M probably benign Het
Itga7 A G 10: 128,941,936 Y262C probably damaging Het
Kif1c A G 11: 70,728,598 T1020A probably benign Het
Kif23 T C 9: 61,937,120 I139V probably benign Het
Klk5 A G 7: 43,850,831 E281G probably benign Het
Kpna4 A G 3: 69,092,848 V275A probably damaging Het
Lamb2 C A 9: 108,485,780 D787E possibly damaging Het
Ldlrad3 A C 2: 101,954,925 V235G probably damaging Het
Maneal A G 4: 124,856,974 S330P probably damaging Het
Maz G A 7: 127,026,317 Q35* probably null Het
Mthfd1l C T 10: 4,089,998 T803M probably damaging Het
Muc5ac A G 7: 141,793,167 Q325R probably benign Het
Myo3a C A 2: 22,407,444 A758E probably benign Het
Ndufb7 A G 8: 83,566,853 D12G probably benign Het
Nsun2 T A 13: 69,633,606 C677S probably damaging Het
Obscn A G 11: 59,008,558 F6471S probably benign Het
Olfr1204 A T 2: 88,852,219 I90F probably damaging Het
Olfr639 A G 7: 104,011,838 V288A possibly damaging Het
Olfr851 T C 9: 19,497,548 S267P probably damaging Het
Otof T C 5: 30,394,661 D313G probably damaging Het
Paqr5 T C 9: 61,972,790 D74G probably benign Het
Pigq A G 17: 25,934,606 V365A unknown Het
Podn A T 4: 108,017,805 N588K probably benign Het
Polr3b G A 10: 84,622,491 G9R probably benign Het
Proser1 A G 3: 53,478,518 H607R probably damaging Het
Ryr2 C T 13: 11,752,282 V1241I probably benign Het
Sar1b G A 11: 51,791,354 A170T probably benign Het
Slc22a17 T C 14: 54,912,259 T191A probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,040 unknown Het
Slco6d1 A T 1: 98,421,357 D51V possibly damaging Het
Snx16 G A 3: 10,435,481 R143* probably null Het
Sytl2 T A 7: 90,348,847 L19Q probably damaging Het
Tmcc3 A G 10: 94,582,312 E345G possibly damaging Het
Ttn C T 2: 76,725,654 A30336T probably damaging Het
Vmn1r44 A G 6: 89,893,419 D49G probably benign Het
Vps41 T A 13: 18,864,034 D801E probably benign Het
Wif1 G A 10: 121,096,649 E311K probably benign Het
Zfp513 G T 5: 31,200,415 R207S possibly damaging Het
Zfp52 C A 17: 21,561,353 H488N probably damaging Het
Zfp738 A G 13: 67,669,500 Y791H probably damaging Het
Other mutations in Ankef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Ankef1 APN 2 136552531 missense possibly damaging 0.87
IGL02194:Ankef1 APN 2 136550509 missense probably benign 0.01
IGL02318:Ankef1 APN 2 136544775 missense possibly damaging 0.48
IGL02398:Ankef1 APN 2 136555782 missense probably damaging 0.98
IGL02930:Ankef1 APN 2 136550325 missense possibly damaging 0.79
R1482:Ankef1 UTSW 2 136550158 missense possibly damaging 0.74
R1692:Ankef1 UTSW 2 136550426 missense probably benign
R2045:Ankef1 UTSW 2 136554738 missense probably benign 0.00
R2074:Ankef1 UTSW 2 136545738 missense possibly damaging 0.62
R4952:Ankef1 UTSW 2 136550529 missense probably damaging 1.00
R5057:Ankef1 UTSW 2 136550360 unclassified probably null
R5113:Ankef1 UTSW 2 136552441 missense probably benign 0.20
R5743:Ankef1 UTSW 2 136549709 splice site probably null
R6120:Ankef1 UTSW 2 136550376 missense probably benign 0.04
R6243:Ankef1 UTSW 2 136537157 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGAATTCAGCCCACATTTGTATTG -3'
(R):5'- CTGGTAAAGAGTCAGGATATGTGATC -3'

Sequencing Primer
(F):5'- CGGCTTTGATGGAATCGT -3'
(R):5'- CTGCCTTAGTTTAGCCTG -3'
Posted On2019-10-07