Incidental Mutation 'R7456:Angpt4'
ID578107
Institutional Source Beutler Lab
Gene Symbol Angpt4
Ensembl Gene ENSMUSG00000027460
Gene Nameangiopoietin 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7456 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location151911210-151945337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151939067 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 412 (Y412H)
Ref Sequence ENSEMBL: ENSMUSP00000028955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028955]
Predicted Effect probably damaging
Transcript: ENSMUST00000028955
AA Change: Y412H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028955
Gene: ENSMUSG00000027460
AA Change: Y412H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 86 95 N/A INTRINSIC
coiled coil region 181 239 N/A INTRINSIC
low complexity region 253 267 N/A INTRINSIC
FBG 292 507 2.23e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the angiopoietin family of secreted growth factors comprising Angiopoietins-1, -2, and -3, all of which bind the TEK Receptor Tyrosine Kinase. Angiopoietin/TEK Receptor Tyrosine Kinase signaling is involved in survival and migration of endothelial cells and regulates vascular remodeling and maintenance of vascular integrity. Angiopoietin/TEK Receptor Tyrosine Kinase signaling is also required for lymphangiogenesis. Family members bind TEK Receptor Tyrosine Kinase as multimeric clusters but their oligomerization properties differ from one another and this is thought to provide a mechanistic basis for their distinct physiologic roles. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,442,933 L612* probably null Het
9030624J02Rik C T 7: 118,804,117 P628S probably benign Het
Acer2 A G 4: 86,874,511 D8G possibly damaging Het
Ankef1 A G 2: 136,545,814 D217G probably benign Het
Ano2 A T 6: 125,963,545 I544F probably benign Het
App G A 16: 85,173,560 Het
Arhgef26 A G 3: 62,340,055 T187A probably benign Het
Axin1 T A 17: 26,143,165 V161E probably damaging Het
Bbs7 A T 3: 36,594,378 V407D probably damaging Het
C1qtnf3 A T 15: 10,972,051 E141V probably benign Het
C2 A G 17: 34,864,582 I469T probably damaging Het
Cc2d1a A G 8: 84,140,239 probably null Het
Cd226 A T 18: 89,206,623 I10F probably damaging Het
Cep295nl T C 11: 118,333,550 K156R possibly damaging Het
Cfap44 A G 16: 44,431,942 T805A probably benign Het
Chd9 G T 8: 90,932,525 E38* probably null Het
Cldnd2 C T 7: 43,441,685 L14F not run Het
Cyp11b2 T C 15: 74,853,530 T247A probably benign Het
Dsc1 T C 18: 20,086,822 S764G probably benign Het
Dsg3 A T 18: 20,531,363 T473S probably benign Het
E330009J07Rik T G 6: 40,406,840 M423L probably benign Het
Fam193a A T 5: 34,420,788 I209F possibly damaging Het
Foxs1 T C 2: 152,933,125 K3E probably benign Het
Gabrr3 C T 16: 59,407,490 Q37* probably null Het
Gcm2 A T 13: 41,103,275 W333R probably benign Het
Gcn1l1 C T 5: 115,604,946 Q1559* probably null Het
Gfm2 A T 13: 97,145,703 K69* probably null Het
Gm14295 T G 2: 176,809,150 C144W possibly damaging Het
Gm32742 G A 9: 51,159,970 T5I probably damaging Het
Gm5093 T C 17: 46,439,753 D116G probably damaging Het
Gsn A T 2: 35,282,706 K3N possibly damaging Het
H2-M2 C T 17: 37,481,661 D240N possibly damaging Het
Habp2 G C 19: 56,319,525 G482R probably damaging Het
Hnrnpm A T 17: 33,646,648 Y680N possibly damaging Het
Hrc T A 7: 45,336,896 D490E possibly damaging Het
Impg2 A G 16: 56,259,913 I693M probably benign Het
Itga7 A G 10: 128,941,936 Y262C probably damaging Het
Kif1c A G 11: 70,728,598 T1020A probably benign Het
Kif23 T C 9: 61,937,120 I139V probably benign Het
Klk5 A G 7: 43,850,831 E281G probably benign Het
Kpna4 A G 3: 69,092,848 V275A probably damaging Het
Lamb2 C A 9: 108,485,780 D787E possibly damaging Het
Ldlrad3 A C 2: 101,954,925 V235G probably damaging Het
Maneal A G 4: 124,856,974 S330P probably damaging Het
Maz G A 7: 127,026,317 Q35* probably null Het
Mthfd1l C T 10: 4,089,998 T803M probably damaging Het
Muc5ac A G 7: 141,793,167 Q325R probably benign Het
Myo3a C A 2: 22,407,444 A758E probably benign Het
Ndufb7 A G 8: 83,566,853 D12G probably benign Het
Nsun2 T A 13: 69,633,606 C677S probably damaging Het
Obscn A G 11: 59,008,558 F6471S probably benign Het
Olfr1204 A T 2: 88,852,219 I90F probably damaging Het
Olfr639 A G 7: 104,011,838 V288A possibly damaging Het
Olfr851 T C 9: 19,497,548 S267P probably damaging Het
Otof T C 5: 30,394,661 D313G probably damaging Het
Paqr5 T C 9: 61,972,790 D74G probably benign Het
Pigq A G 17: 25,934,606 V365A unknown Het
Podn A T 4: 108,017,805 N588K probably benign Het
Polr3b G A 10: 84,622,491 G9R probably benign Het
Proser1 A G 3: 53,478,518 H607R probably damaging Het
Ryr2 C T 13: 11,752,282 V1241I probably benign Het
Sar1b G A 11: 51,791,354 A170T probably benign Het
Slc22a17 T C 14: 54,912,259 T191A probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,040 unknown Het
Slco6d1 A T 1: 98,421,357 D51V possibly damaging Het
Snx16 G A 3: 10,435,481 R143* probably null Het
Sytl2 T A 7: 90,348,847 L19Q probably damaging Het
Tmcc3 A G 10: 94,582,312 E345G possibly damaging Het
Ttn C T 2: 76,725,654 A30336T probably damaging Het
Vmn1r44 A G 6: 89,893,419 D49G probably benign Het
Vps41 T A 13: 18,864,034 D801E probably benign Het
Wif1 G A 10: 121,096,649 E311K probably benign Het
Zfp513 G T 5: 31,200,415 R207S possibly damaging Het
Zfp52 C A 17: 21,561,353 H488N probably damaging Het
Zfp738 A G 13: 67,669,500 Y791H probably damaging Het
Other mutations in Angpt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Angpt4 APN 2 151911471 missense probably damaging 0.99
IGL03107:Angpt4 APN 2 151943422 missense probably benign 0.08
IGL03343:Angpt4 APN 2 151936703 missense probably damaging 1.00
R0034:Angpt4 UTSW 2 151929391 missense probably benign 0.44
R0709:Angpt4 UTSW 2 151934514 missense possibly damaging 0.46
R0764:Angpt4 UTSW 2 151911284 start gained probably benign
R0853:Angpt4 UTSW 2 151938927 missense probably damaging 1.00
R1796:Angpt4 UTSW 2 151938989 missense probably damaging 1.00
R2091:Angpt4 UTSW 2 151936783 splice site probably benign
R2184:Angpt4 UTSW 2 151938954 missense probably damaging 1.00
R2901:Angpt4 UTSW 2 151911339 missense unknown
R3014:Angpt4 UTSW 2 151929597 missense probably benign 0.07
R4192:Angpt4 UTSW 2 151943318 missense probably benign
R4440:Angpt4 UTSW 2 151944646 missense probably damaging 1.00
R5059:Angpt4 UTSW 2 151934440 missense probably damaging 1.00
R5326:Angpt4 UTSW 2 151925544 critical splice donor site probably null
R6345:Angpt4 UTSW 2 151929434 missense probably benign 0.00
R7232:Angpt4 UTSW 2 151929540 missense possibly damaging 0.63
R7313:Angpt4 UTSW 2 151925406 missense probably benign
R7598:Angpt4 UTSW 2 151925525 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCCACAGGGTTTTGGTAATGTG -3'
(R):5'- TAACCTTGGAGGAGCCCTTC -3'

Sequencing Primer
(F):5'- TTGGTAATGTGGCCAGAGAGCAC -3'
(R):5'- CCCAGTGTCCAAAATGTGCTGAG -3'
Posted On2019-10-07