Incidental Mutation 'R7456:Gcn1l1'
ID578121
Institutional Source Beutler Lab
Gene Symbol Gcn1l1
Ensembl Gene ENSMUSG00000041638
Gene NameGCN1 general control of amino-acid synthesis 1-like 1 (yeast)
SynonymsGCN1L, G431004K08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R7456 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location115565254-115622654 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 115604946 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1559 (Q1559*)
Ref Sequence ENSEMBL: ENSMUSP00000069432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064454]
Predicted Effect probably null
Transcript: ENSMUST00000064454
AA Change: Q1559*
SMART Domains Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: Q1559*

DomainStartEndE-ValueType
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF3554 357 705 2e-61 PFAM
coiled coil region 806 866 N/A INTRINSIC
Blast:ARM 1028 1068 6e-11 BLAST
coiled coil region 1180 1203 N/A INTRINSIC
low complexity region 1457 1466 N/A INTRINSIC
low complexity region 1501 1510 N/A INTRINSIC
ARM 1527 1567 3.69e1 SMART
Blast:ARM 1602 1644 1e-5 BLAST
Blast:EZ_HEAT 1671 1704 1e-7 BLAST
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 1956 1972 N/A INTRINSIC
ARM 2034 2070 9.27e1 SMART
low complexity region 2326 2334 N/A INTRINSIC
ARM 2416 2455 2.16e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,442,933 L612* probably null Het
9030624J02Rik C T 7: 118,804,117 P628S probably benign Het
Acer2 A G 4: 86,874,511 D8G possibly damaging Het
Angpt4 T C 2: 151,939,067 Y412H probably damaging Het
Ankef1 A G 2: 136,545,814 D217G probably benign Het
Ano2 A T 6: 125,963,545 I544F probably benign Het
App G A 16: 85,173,560 Het
Arhgef26 A G 3: 62,340,055 T187A probably benign Het
Axin1 T A 17: 26,143,165 V161E probably damaging Het
Bbs7 A T 3: 36,594,378 V407D probably damaging Het
C1qtnf3 A T 15: 10,972,051 E141V probably benign Het
C2 A G 17: 34,864,582 I469T probably damaging Het
Cc2d1a A G 8: 84,140,239 probably null Het
Cd226 A T 18: 89,206,623 I10F probably damaging Het
Cep295nl T C 11: 118,333,550 K156R possibly damaging Het
Cfap44 A G 16: 44,431,942 T805A probably benign Het
Chd9 G T 8: 90,932,525 E38* probably null Het
Cldnd2 C T 7: 43,441,685 L14F not run Het
Cyp11b2 T C 15: 74,853,530 T247A probably benign Het
Dsc1 T C 18: 20,086,822 S764G probably benign Het
Dsg3 A T 18: 20,531,363 T473S probably benign Het
E330009J07Rik T G 6: 40,406,840 M423L probably benign Het
Fam193a A T 5: 34,420,788 I209F possibly damaging Het
Foxs1 T C 2: 152,933,125 K3E probably benign Het
Gabrr3 C T 16: 59,407,490 Q37* probably null Het
Gcm2 A T 13: 41,103,275 W333R probably benign Het
Gfm2 A T 13: 97,145,703 K69* probably null Het
Gm14295 T G 2: 176,809,150 C144W possibly damaging Het
Gm32742 G A 9: 51,159,970 T5I probably damaging Het
Gm5093 T C 17: 46,439,753 D116G probably damaging Het
Gsn A T 2: 35,282,706 K3N possibly damaging Het
H2-M2 C T 17: 37,481,661 D240N possibly damaging Het
Habp2 G C 19: 56,319,525 G482R probably damaging Het
Hnrnpm A T 17: 33,646,648 Y680N possibly damaging Het
Hrc T A 7: 45,336,896 D490E possibly damaging Het
Impg2 A G 16: 56,259,913 I693M probably benign Het
Itga7 A G 10: 128,941,936 Y262C probably damaging Het
Kif1c A G 11: 70,728,598 T1020A probably benign Het
Kif23 T C 9: 61,937,120 I139V probably benign Het
Klk5 A G 7: 43,850,831 E281G probably benign Het
Kpna4 A G 3: 69,092,848 V275A probably damaging Het
Lamb2 C A 9: 108,485,780 D787E possibly damaging Het
Ldlrad3 A C 2: 101,954,925 V235G probably damaging Het
Maneal A G 4: 124,856,974 S330P probably damaging Het
Maz G A 7: 127,026,317 Q35* probably null Het
Mthfd1l C T 10: 4,089,998 T803M probably damaging Het
Muc5ac A G 7: 141,793,167 Q325R probably benign Het
Myo3a C A 2: 22,407,444 A758E probably benign Het
Ndufb7 A G 8: 83,566,853 D12G probably benign Het
Nsun2 T A 13: 69,633,606 C677S probably damaging Het
Obscn A G 11: 59,008,558 F6471S probably benign Het
Olfr1204 A T 2: 88,852,219 I90F probably damaging Het
Olfr639 A G 7: 104,011,838 V288A possibly damaging Het
Olfr851 T C 9: 19,497,548 S267P probably damaging Het
Otof T C 5: 30,394,661 D313G probably damaging Het
Paqr5 T C 9: 61,972,790 D74G probably benign Het
Pigq A G 17: 25,934,606 V365A unknown Het
Podn A T 4: 108,017,805 N588K probably benign Het
Polr3b G A 10: 84,622,491 G9R probably benign Het
Proser1 A G 3: 53,478,518 H607R probably damaging Het
Ryr2 C T 13: 11,752,282 V1241I probably benign Het
Sar1b G A 11: 51,791,354 A170T probably benign Het
Slc22a17 T C 14: 54,912,259 T191A probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,040 unknown Het
Slco6d1 A T 1: 98,421,357 D51V possibly damaging Het
Snx16 G A 3: 10,435,481 R143* probably null Het
Sytl2 T A 7: 90,348,847 L19Q probably damaging Het
Tmcc3 A G 10: 94,582,312 E345G possibly damaging Het
Ttn C T 2: 76,725,654 A30336T probably damaging Het
Vmn1r44 A G 6: 89,893,419 D49G probably benign Het
Vps41 T A 13: 18,864,034 D801E probably benign Het
Wif1 G A 10: 121,096,649 E311K probably benign Het
Zfp513 G T 5: 31,200,415 R207S possibly damaging Het
Zfp52 C A 17: 21,561,353 H488N probably damaging Het
Zfp738 A G 13: 67,669,500 Y791H probably damaging Het
Other mutations in Gcn1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Gcn1l1 APN 5 115588143 splice site probably benign
IGL00974:Gcn1l1 APN 5 115613793 missense possibly damaging 0.88
IGL01566:Gcn1l1 APN 5 115611058 missense probably damaging 1.00
IGL01843:Gcn1l1 APN 5 115619700 missense probably damaging 1.00
IGL01885:Gcn1l1 APN 5 115576115 splice site probably null
IGL02081:Gcn1l1 APN 5 115585871 missense probably damaging 1.00
IGL02118:Gcn1l1 APN 5 115610879 missense probably damaging 1.00
IGL02150:Gcn1l1 APN 5 115609868 missense probably damaging 1.00
IGL02190:Gcn1l1 APN 5 115614124 missense probably damaging 1.00
IGL02219:Gcn1l1 APN 5 115613767 missense possibly damaging 0.68
IGL02507:Gcn1l1 APN 5 115585881 missense probably benign 0.11
IGL02644:Gcn1l1 APN 5 115575191 missense probably benign
IGL02678:Gcn1l1 APN 5 115613755 missense probably damaging 0.99
IGL02748:Gcn1l1 APN 5 115610800 splice site probably null
IGL02755:Gcn1l1 APN 5 115604006 splice site probably null
IGL02896:Gcn1l1 APN 5 115619648 splice site probably benign
IGL03147:Gcn1l1 UTSW 5 115610858 missense possibly damaging 0.78
R0362:Gcn1l1 UTSW 5 115576108 splice site probably benign
R0540:Gcn1l1 UTSW 5 115588956 missense probably benign 0.00
R0569:Gcn1l1 UTSW 5 115595059 missense probably benign 0.00
R0570:Gcn1l1 UTSW 5 115592421 missense probably damaging 1.00
R0584:Gcn1l1 UTSW 5 115595015 missense probably damaging 1.00
R0630:Gcn1l1 UTSW 5 115581089 missense probably benign 0.06
R0656:Gcn1l1 UTSW 5 115589303 missense probably benign 0.27
R0801:Gcn1l1 UTSW 5 115591006 missense probably benign 0.12
R0890:Gcn1l1 UTSW 5 115579793 missense possibly damaging 0.77
R1400:Gcn1l1 UTSW 5 115614161 missense probably damaging 1.00
R1485:Gcn1l1 UTSW 5 115574617 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1673:Gcn1l1 UTSW 5 115582297 missense probably benign
R1894:Gcn1l1 UTSW 5 115589115 missense probably damaging 1.00
R2114:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2116:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2117:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2152:Gcn1l1 UTSW 5 115609829 missense probably benign 0.07
R2162:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R2216:Gcn1l1 UTSW 5 115593661 missense probably benign
R2218:Gcn1l1 UTSW 5 115619661 missense probably benign 0.04
R2278:Gcn1l1 UTSW 5 115611175 missense probably damaging 1.00
R2280:Gcn1l1 UTSW 5 115612730 missense probably damaging 1.00
R3719:Gcn1l1 UTSW 5 115579817 missense probably benign 0.03
R3729:Gcn1l1 UTSW 5 115583394 splice site probably benign
R3833:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R3932:Gcn1l1 UTSW 5 115587834 missense probably benign 0.11
R4067:Gcn1l1 UTSW 5 115599088 missense probably damaging 1.00
R4152:Gcn1l1 UTSW 5 115613354 critical splice acceptor site probably null
R4179:Gcn1l1 UTSW 5 115588050 missense probably benign 0.00
R4292:Gcn1l1 UTSW 5 115576148 missense possibly damaging 0.49
R4350:Gcn1l1 UTSW 5 115603330 missense probably damaging 1.00
R4493:Gcn1l1 UTSW 5 115594144 missense probably benign
R4672:Gcn1l1 UTSW 5 115606520 missense probably damaging 1.00
R4749:Gcn1l1 UTSW 5 115614402 missense probably benign
R4753:Gcn1l1 UTSW 5 115616478 missense probably benign
R4826:Gcn1l1 UTSW 5 115593693 missense probably benign
R4873:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4875:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4932:Gcn1l1 UTSW 5 115592144 missense probably benign 0.00
R4992:Gcn1l1 UTSW 5 115599166 missense probably benign 0.29
R5049:Gcn1l1 UTSW 5 115606671 missense probably damaging 1.00
R5211:Gcn1l1 UTSW 5 115619312 missense probably benign 0.04
R5226:Gcn1l1 UTSW 5 115588067 missense probably benign 0.01
R5338:Gcn1l1 UTSW 5 115583403 missense probably benign 0.00
R5914:Gcn1l1 UTSW 5 115610135 synonymous silent
R5932:Gcn1l1 UTSW 5 115592376 missense possibly damaging 0.77
R6422:Gcn1l1 UTSW 5 115609544 missense probably damaging 1.00
R6435:Gcn1l1 UTSW 5 115611022 critical splice acceptor site probably null
R6607:Gcn1l1 UTSW 5 115609478 missense probably damaging 0.98
R6724:Gcn1l1 UTSW 5 115609158 intron probably null
R6861:Gcn1l1 UTSW 5 115611049 missense probably benign
R6875:Gcn1l1 UTSW 5 115588110 missense probably damaging 1.00
R6910:Gcn1l1 UTSW 5 115606538 missense probably benign 0.42
R6975:Gcn1l1 UTSW 5 115613459 missense probably damaging 1.00
R7027:Gcn1l1 UTSW 5 115616546 critical splice donor site probably null
R7038:Gcn1l1 UTSW 5 115611144 missense probably damaging 1.00
R7171:Gcn1l1 UTSW 5 115590293 missense probably benign 0.02
R7276:Gcn1l1 UTSW 5 115611060 missense probably damaging 1.00
R7473:Gcn1l1 UTSW 5 115581804 missense probably benign 0.09
R7517:Gcn1l1 UTSW 5 115619696 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAAAATGTGCTGGTGAGTGTC -3'
(R):5'- AAGCGCCTTCAACCATTTAGTC -3'

Sequencing Primer
(F):5'- TCGAGTGTCTCAGTGCTGCAC -3'
(R):5'- TAGTCTAACTAAGAAAGGGGCTTCCC -3'
Posted On2019-10-07