Incidental Mutation 'R7456:Polr3b'
ID 578143
Institutional Source Beutler Lab
Gene Symbol Polr3b
Ensembl Gene ENSMUSG00000034453
Gene Name polymerase (RNA) III (DNA directed) polypeptide B
Synonyms RPC2, A330032P03Rik, 2700078H01Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027423

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7456 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 84622292-84727178 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 84622491 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 9 (G9R)
Ref Sequence ENSEMBL: ENSMUSP00000076418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077175]
AlphaFold P59470
Predicted Effect probably benign
Transcript: ENSMUST00000077175
AA Change: G9R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453
AA Change: G9R

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 38 413 2e-55 PFAM
Pfam:RNA_pol_Rpb2_2 185 363 8.4e-29 PFAM
Pfam:RNA_pol_Rpb2_3 438 502 2.6e-22 PFAM
Pfam:RNA_pol_Rpb2_4 539 600 1e-29 PFAM
Pfam:RNA_pol_Rpb2_5 621 661 6.5e-14 PFAM
Pfam:RNA_pol_Rpb2_6 668 1041 5.8e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1043 1129 7.6e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,442,933 L612* probably null Het
9030624J02Rik C T 7: 118,804,117 P628S probably benign Het
Acer2 A G 4: 86,874,511 D8G possibly damaging Het
Angpt4 T C 2: 151,939,067 Y412H probably damaging Het
Ankef1 A G 2: 136,545,814 D217G probably benign Het
Ano2 A T 6: 125,963,545 I544F probably benign Het
App G A 16: 85,173,560 Het
Arhgef26 A G 3: 62,340,055 T187A probably benign Het
Axin1 T A 17: 26,143,165 V161E probably damaging Het
Bbs7 A T 3: 36,594,378 V407D probably damaging Het
C1qtnf3 A T 15: 10,972,051 E141V probably benign Het
C2 A G 17: 34,864,582 I469T probably damaging Het
Cc2d1a A G 8: 84,140,239 probably null Het
Cd226 A T 18: 89,206,623 I10F probably damaging Het
Cep295nl T C 11: 118,333,550 K156R possibly damaging Het
Cfap44 A G 16: 44,431,942 T805A probably benign Het
Chd9 G T 8: 90,932,525 E38* probably null Het
Cldnd2 C T 7: 43,441,685 L14F not run Het
Cyp11b2 T C 15: 74,853,530 T247A probably benign Het
Dsc1 T C 18: 20,086,822 S764G probably benign Het
Dsg3 A T 18: 20,531,363 T473S probably benign Het
E330009J07Rik T G 6: 40,406,840 M423L probably benign Het
Fam193a A T 5: 34,420,788 I209F possibly damaging Het
Foxs1 T C 2: 152,933,125 K3E probably benign Het
Gabrr3 C T 16: 59,407,490 Q37* probably null Het
Gcm2 A T 13: 41,103,275 W333R probably benign Het
Gcn1l1 C T 5: 115,604,946 Q1559* probably null Het
Gfm2 A T 13: 97,145,703 K69* probably null Het
Gm14295 T G 2: 176,809,150 C144W possibly damaging Het
Gm32742 G A 9: 51,159,970 T5I probably damaging Het
Gm5093 T C 17: 46,439,753 D116G probably damaging Het
Gsn A T 2: 35,282,706 K3N possibly damaging Het
H2-M2 C T 17: 37,481,661 D240N possibly damaging Het
Habp2 G C 19: 56,319,525 G482R probably damaging Het
Hnrnpm A T 17: 33,646,648 Y680N possibly damaging Het
Hrc T A 7: 45,336,896 D490E possibly damaging Het
Impg2 A G 16: 56,259,913 I693M probably benign Het
Itga7 A G 10: 128,941,936 Y262C probably damaging Het
Kif1c A G 11: 70,728,598 T1020A probably benign Het
Kif23 T C 9: 61,937,120 I139V probably benign Het
Klk5 A G 7: 43,850,831 E281G probably benign Het
Kpna4 A G 3: 69,092,848 V275A probably damaging Het
Lamb2 C A 9: 108,485,780 D787E possibly damaging Het
Ldlrad3 A C 2: 101,954,925 V235G probably damaging Het
Maneal A G 4: 124,856,974 S330P probably damaging Het
Maz G A 7: 127,026,317 Q35* probably null Het
Mthfd1l C T 10: 4,089,998 T803M probably damaging Het
Muc5ac A G 7: 141,793,167 Q325R probably benign Het
Myo3a C A 2: 22,407,444 A758E probably benign Het
Ndufb7 A G 8: 83,566,853 D12G probably benign Het
Nsun2 T A 13: 69,633,606 C677S probably damaging Het
Obscn A G 11: 59,008,558 F6471S probably benign Het
Olfr1204 A T 2: 88,852,219 I90F probably damaging Het
Olfr639 A G 7: 104,011,838 V288A possibly damaging Het
Olfr851 T C 9: 19,497,548 S267P probably damaging Het
Otof T C 5: 30,394,661 D313G probably damaging Het
Paqr5 T C 9: 61,972,790 D74G probably benign Het
Pigq A G 17: 25,934,606 V365A unknown Het
Podn A T 4: 108,017,805 N588K probably benign Het
Proser1 A G 3: 53,478,518 H607R probably damaging Het
Ryr2 C T 13: 11,752,282 V1241I probably benign Het
Sar1b G A 11: 51,791,354 A170T probably benign Het
Slc22a17 T C 14: 54,912,259 T191A probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,040 unknown Het
Slco6d1 A T 1: 98,421,357 D51V possibly damaging Het
Snx16 G A 3: 10,435,481 R143* probably null Het
Sytl2 T A 7: 90,348,847 L19Q probably damaging Het
Tmcc3 A G 10: 94,582,312 E345G possibly damaging Het
Ttn C T 2: 76,725,654 A30336T probably damaging Het
Vmn1r44 A G 6: 89,893,419 D49G probably benign Het
Vps41 T A 13: 18,864,034 D801E probably benign Het
Wif1 G A 10: 121,096,649 E311K probably benign Het
Zfp513 G T 5: 31,200,415 R207S possibly damaging Het
Zfp52 C A 17: 21,561,353 H488N probably damaging Het
Zfp738 A G 13: 67,669,500 Y791H probably damaging Het
Other mutations in Polr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Polr3b APN 10 84676990 missense probably benign
IGL00848:Polr3b APN 10 84680377 missense probably damaging 1.00
IGL00901:Polr3b APN 10 84631796 missense possibly damaging 0.94
IGL01313:Polr3b APN 10 84725743 missense probably damaging 1.00
IGL01364:Polr3b APN 10 84695669 missense probably benign 0.00
IGL01731:Polr3b APN 10 84631840 nonsense probably null
IGL03326:Polr3b APN 10 84667395 missense probably benign 0.43
IGL03369:Polr3b APN 10 84676952 missense probably damaging 1.00
etruscan UTSW 10 84632538 missense probably benign 0.00
pennyweight UTSW 10 84713632 missense probably damaging 1.00
pinhead UTSW 10 84655991 missense probably damaging 1.00
G5538:Polr3b UTSW 10 84631794 missense probably benign 0.21
PIT4382001:Polr3b UTSW 10 84684185 missense probably damaging 1.00
R0180:Polr3b UTSW 10 84622515 missense probably benign
R0270:Polr3b UTSW 10 84718475 missense probably benign 0.02
R0541:Polr3b UTSW 10 84638064 missense probably damaging 1.00
R0890:Polr3b UTSW 10 84714336 missense probably benign 0.01
R1302:Polr3b UTSW 10 84632486 missense probably damaging 0.97
R1511:Polr3b UTSW 10 84680385 missense probably benign
R1561:Polr3b UTSW 10 84634912 missense probably damaging 1.00
R1607:Polr3b UTSW 10 84652783 missense probably benign 0.00
R1624:Polr3b UTSW 10 84679805 missense probably damaging 0.98
R1809:Polr3b UTSW 10 84693001 missense probably damaging 1.00
R1830:Polr3b UTSW 10 84692922 nonsense probably null
R2973:Polr3b UTSW 10 84628280 missense probably benign 0.00
R3401:Polr3b UTSW 10 84699491 missense probably damaging 0.96
R3876:Polr3b UTSW 10 84720518 critical splice donor site probably null
R3961:Polr3b UTSW 10 84684302 missense possibly damaging 0.89
R4664:Polr3b UTSW 10 84714369 missense probably damaging 1.00
R4721:Polr3b UTSW 10 84656003 missense possibly damaging 0.56
R4972:Polr3b UTSW 10 84638124 missense probably damaging 1.00
R5065:Polr3b UTSW 10 84632538 missense probably benign 0.00
R5264:Polr3b UTSW 10 84667416 missense probably benign 0.02
R5302:Polr3b UTSW 10 84699400 missense possibly damaging 0.59
R5795:Polr3b UTSW 10 84628252 missense probably benign
R5795:Polr3b UTSW 10 84677011 missense probably damaging 0.97
R5838:Polr3b UTSW 10 84674590 missense probably benign 0.09
R6419:Polr3b UTSW 10 84638111 missense possibly damaging 0.78
R6568:Polr3b UTSW 10 84634903 missense probably damaging 1.00
R6787:Polr3b UTSW 10 84628625 critical splice acceptor site probably null
R6913:Polr3b UTSW 10 84713632 missense probably damaging 1.00
R7405:Polr3b UTSW 10 84684179 missense probably benign
R7657:Polr3b UTSW 10 84655991 missense probably damaging 1.00
R8074:Polr3b UTSW 10 84713659 missense probably damaging 1.00
R8082:Polr3b UTSW 10 84656063 missense probably damaging 1.00
R8127:Polr3b UTSW 10 84679789 missense probably benign
R8676:Polr3b UTSW 10 84680387 missense probably benign 0.00
R8744:Polr3b UTSW 10 84628624 splice site probably benign
R8797:Polr3b UTSW 10 84697015 nonsense probably null
R8866:Polr3b UTSW 10 84695691 missense probably benign 0.14
R9006:Polr3b UTSW 10 84631833 missense probably benign 0.05
R9397:Polr3b UTSW 10 84631789 missense possibly damaging 0.93
X0066:Polr3b UTSW 10 84713695 missense probably damaging 0.97
Z1177:Polr3b UTSW 10 84714293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACCTTTTGAAACGCCTCC -3'
(R):5'- GCTGCTACAAACGCTCAAG -3'

Sequencing Primer
(F):5'- TTTTGAAACGCCTCCCCGTAAAC -3'
(R):5'- GCTCCGAGCATGTGCAGAAG -3'
Posted On 2019-10-07