Incidental Mutation 'R7456:Dsc1'
ID578172
Institutional Source Beutler Lab
Gene Symbol Dsc1
Ensembl Gene ENSMUSG00000044322
Gene Namedesmocollin 1
SynonymsDsc1a, Dsc1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7456 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20084184-20114871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20086822 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 764 (S764G)
Ref Sequence ENSEMBL: ENSMUSP00000042303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038710] [ENSMUST00000224432]
Predicted Effect probably benign
Transcript: ENSMUST00000038710
AA Change: S764G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042303
Gene: ENSMUSG00000044322
AA Change: S764G

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Cadherin_pro 29 111 2.61e-41 SMART
CA 155 240 2.78e-9 SMART
CA 264 352 5.94e-27 SMART
CA 375 470 5.27e-10 SMART
CA 493 575 1.18e-21 SMART
Blast:CA 593 672 5e-46 BLAST
transmembrane domain 692 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224432
AA Change: S764G

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional protein. Mice lacking the encoded protein exhibit epidermal fragility together with defects of epidermal barrier and differentiation. The neonatal mice lacking the encoded protein exhibit epidermal lesions and older mice develop chronic dermatitis. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants with targeted disruptions of this gene have fragile epidermis, flaky skin, and defects in the epidermal barrier, leading to chronic dermatitis and display abnormal epidermal differentiation as indicated by hyperproliferation and overxpression of keratin 6 and 16. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,442,933 L612* probably null Het
9030624J02Rik C T 7: 118,804,117 P628S probably benign Het
Acer2 A G 4: 86,874,511 D8G possibly damaging Het
Angpt4 T C 2: 151,939,067 Y412H probably damaging Het
Ankef1 A G 2: 136,545,814 D217G probably benign Het
Ano2 A T 6: 125,963,545 I544F probably benign Het
App G A 16: 85,173,560 Het
Arhgef26 A G 3: 62,340,055 T187A probably benign Het
Axin1 T A 17: 26,143,165 V161E probably damaging Het
Bbs7 A T 3: 36,594,378 V407D probably damaging Het
C1qtnf3 A T 15: 10,972,051 E141V probably benign Het
C2 A G 17: 34,864,582 I469T probably damaging Het
Cc2d1a A G 8: 84,140,239 probably null Het
Cd226 A T 18: 89,206,623 I10F probably damaging Het
Cep295nl T C 11: 118,333,550 K156R possibly damaging Het
Cfap44 A G 16: 44,431,942 T805A probably benign Het
Chd9 G T 8: 90,932,525 E38* probably null Het
Cldnd2 C T 7: 43,441,685 L14F not run Het
Cyp11b2 T C 15: 74,853,530 T247A probably benign Het
Dsg3 A T 18: 20,531,363 T473S probably benign Het
E330009J07Rik T G 6: 40,406,840 M423L probably benign Het
Fam193a A T 5: 34,420,788 I209F possibly damaging Het
Foxs1 T C 2: 152,933,125 K3E probably benign Het
Gabrr3 C T 16: 59,407,490 Q37* probably null Het
Gcm2 A T 13: 41,103,275 W333R probably benign Het
Gcn1l1 C T 5: 115,604,946 Q1559* probably null Het
Gfm2 A T 13: 97,145,703 K69* probably null Het
Gm14295 T G 2: 176,809,150 C144W possibly damaging Het
Gm32742 G A 9: 51,159,970 T5I probably damaging Het
Gm5093 T C 17: 46,439,753 D116G probably damaging Het
Gsn A T 2: 35,282,706 K3N possibly damaging Het
H2-M2 C T 17: 37,481,661 D240N possibly damaging Het
Habp2 G C 19: 56,319,525 G482R probably damaging Het
Hnrnpm A T 17: 33,646,648 Y680N possibly damaging Het
Hrc T A 7: 45,336,896 D490E possibly damaging Het
Impg2 A G 16: 56,259,913 I693M probably benign Het
Itga7 A G 10: 128,941,936 Y262C probably damaging Het
Kif1c A G 11: 70,728,598 T1020A probably benign Het
Kif23 T C 9: 61,937,120 I139V probably benign Het
Klk5 A G 7: 43,850,831 E281G probably benign Het
Kpna4 A G 3: 69,092,848 V275A probably damaging Het
Lamb2 C A 9: 108,485,780 D787E possibly damaging Het
Ldlrad3 A C 2: 101,954,925 V235G probably damaging Het
Maneal A G 4: 124,856,974 S330P probably damaging Het
Maz G A 7: 127,026,317 Q35* probably null Het
Mthfd1l C T 10: 4,089,998 T803M probably damaging Het
Muc5ac A G 7: 141,793,167 Q325R probably benign Het
Myo3a C A 2: 22,407,444 A758E probably benign Het
Ndufb7 A G 8: 83,566,853 D12G probably benign Het
Nsun2 T A 13: 69,633,606 C677S probably damaging Het
Obscn A G 11: 59,008,558 F6471S probably benign Het
Olfr1204 A T 2: 88,852,219 I90F probably damaging Het
Olfr639 A G 7: 104,011,838 V288A possibly damaging Het
Olfr851 T C 9: 19,497,548 S267P probably damaging Het
Otof T C 5: 30,394,661 D313G probably damaging Het
Paqr5 T C 9: 61,972,790 D74G probably benign Het
Pigq A G 17: 25,934,606 V365A unknown Het
Podn A T 4: 108,017,805 N588K probably benign Het
Polr3b G A 10: 84,622,491 G9R probably benign Het
Proser1 A G 3: 53,478,518 H607R probably damaging Het
Ryr2 C T 13: 11,752,282 V1241I probably benign Het
Sar1b G A 11: 51,791,354 A170T probably benign Het
Slc22a17 T C 14: 54,912,259 T191A probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,040 unknown Het
Slco6d1 A T 1: 98,421,357 D51V possibly damaging Het
Snx16 G A 3: 10,435,481 R143* probably null Het
Sytl2 T A 7: 90,348,847 L19Q probably damaging Het
Tmcc3 A G 10: 94,582,312 E345G possibly damaging Het
Ttn C T 2: 76,725,654 A30336T probably damaging Het
Vmn1r44 A G 6: 89,893,419 D49G probably benign Het
Vps41 T A 13: 18,864,034 D801E probably benign Het
Wif1 G A 10: 121,096,649 E311K probably benign Het
Zfp513 G T 5: 31,200,415 R207S possibly damaging Het
Zfp52 C A 17: 21,561,353 H488N probably damaging Het
Zfp738 A G 13: 67,669,500 Y791H probably damaging Het
Other mutations in Dsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Dsc1 APN 18 20101886 missense probably damaging 1.00
IGL00571:Dsc1 APN 18 20110138 missense probably damaging 1.00
IGL00790:Dsc1 APN 18 20094896 missense probably damaging 1.00
IGL00963:Dsc1 APN 18 20111986 missense probably null 0.01
IGL00972:Dsc1 APN 18 20088363 missense probably benign 0.32
IGL01112:Dsc1 APN 18 20094622 missense probably benign 0.02
IGL01458:Dsc1 APN 18 20099138 missense probably damaging 1.00
IGL01607:Dsc1 APN 18 20089663 missense probably damaging 1.00
IGL01794:Dsc1 APN 18 20110183 missense probably damaging 1.00
IGL01959:Dsc1 APN 18 20097225 missense probably damaging 1.00
IGL02066:Dsc1 APN 18 20108803 unclassified probably benign
IGL02365:Dsc1 APN 18 20108816 missense probably damaging 1.00
IGL02714:Dsc1 APN 18 20087485 missense probably damaging 1.00
IGL02959:Dsc1 APN 18 20108885 missense probably damaging 1.00
IGL03019:Dsc1 APN 18 20088364 missense probably benign 0.00
IGL03106:Dsc1 APN 18 20086644 splice site probably null
R0414:Dsc1 UTSW 18 20088354 missense possibly damaging 0.85
R0456:Dsc1 UTSW 18 20099112 missense probably damaging 1.00
R0612:Dsc1 UTSW 18 20114516 missense probably damaging 0.96
R0630:Dsc1 UTSW 18 20085862 missense probably damaging 1.00
R0646:Dsc1 UTSW 18 20096057 missense probably damaging 1.00
R0928:Dsc1 UTSW 18 20110249 splice site probably null
R0976:Dsc1 UTSW 18 20095041 splice site probably null
R1221:Dsc1 UTSW 18 20114542 nonsense probably null
R1398:Dsc1 UTSW 18 20088336 missense probably damaging 1.00
R1902:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R1903:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R2070:Dsc1 UTSW 18 20088296 splice site probably null
R2119:Dsc1 UTSW 18 20110152 missense probably benign 0.07
R3935:Dsc1 UTSW 18 20097241 missense probably benign 0.00
R4747:Dsc1 UTSW 18 20094558 missense probably damaging 1.00
R5034:Dsc1 UTSW 18 20095027 missense possibly damaging 0.91
R5243:Dsc1 UTSW 18 20099159 missense probably damaging 1.00
R5289:Dsc1 UTSW 18 20101853 missense possibly damaging 0.72
R5300:Dsc1 UTSW 18 20094860 missense probably damaging 1.00
R5354:Dsc1 UTSW 18 20087575 missense probably damaging 1.00
R5376:Dsc1 UTSW 18 20088446 missense probably benign 0.21
R5808:Dsc1 UTSW 18 20086829 nonsense probably null
R5860:Dsc1 UTSW 18 20095024 missense probably damaging 1.00
R6059:Dsc1 UTSW 18 20110242 missense probably damaging 0.98
R6116:Dsc1 UTSW 18 20097299 missense probably benign 0.10
R6351:Dsc1 UTSW 18 20086769 missense probably damaging 1.00
R6422:Dsc1 UTSW 18 20095033 missense probably damaging 1.00
R6811:Dsc1 UTSW 18 20089654 missense probably benign
R6880:Dsc1 UTSW 18 20088372 missense probably damaging 0.99
R6941:Dsc1 UTSW 18 20097189 missense probably benign 0.00
R6997:Dsc1 UTSW 18 20086644 splice site probably null
R7255:Dsc1 UTSW 18 20097273 missense probably benign 0.12
R7492:Dsc1 UTSW 18 20107680 missense possibly damaging 0.46
R7503:Dsc1 UTSW 18 20085865 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACTTCACCAAGCCGAGGTTG -3'
(R):5'- TGATTGCATCTACAGTGACCC -3'

Sequencing Primer
(F):5'- CCGAGGTTGAGTGAAAGTTTGCC -3'
(R):5'- CCTGGAGTTAGGACCTCAACATATAG -3'
Posted On2019-10-07