Incidental Mutation 'R7457:Gzf1'
ID 578183
Institutional Source Beutler Lab
Gene Symbol Gzf1
Ensembl Gene ENSMUSG00000027439
Gene Name GDNF-inducible zinc finger protein 1
Synonyms Zfp336, 8430437G08Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_028986.3; MGI:1921783

Is this an essential gene? Possibly essential (E-score: 0.636) question?
Stock # R7457 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 148681023-148692949 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 148690082 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 543 (R543L)
Ref Sequence ENSEMBL: ENSMUSP00000028928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028926] [ENSMUST00000028928] [ENSMUST00000136513]
AlphaFold Q4VBD9
Predicted Effect probably benign
Transcript: ENSMUST00000028926
SMART Domains Protein: ENSMUSP00000028926
Gene: ENSMUSG00000027438

DomainStartEndE-ValueType
Pfam:SNAP 8 288 7.3e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000028928
AA Change: R543L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028928
Gene: ENSMUSG00000027439
AA Change: R543L

DomainStartEndE-ValueType
BTB 31 133 2.01e-20 SMART
low complexity region 199 213 N/A INTRINSIC
coiled coil region 287 308 N/A INTRINSIC
ZnF_C2H2 315 337 6.32e-3 SMART
ZnF_C2H2 346 369 1.2e-3 SMART
ZnF_C2H2 375 398 8.34e-3 SMART
ZnF_C2H2 405 427 7.78e-3 SMART
ZnF_C2H2 433 455 1.69e-3 SMART
ZnF_C2H2 461 483 1.43e-1 SMART
ZnF_C2H2 489 511 2.4e-3 SMART
ZnF_C2H2 517 539 1.47e-3 SMART
ZnF_C2H2 545 567 1.38e-3 SMART
ZnF_C2H2 573 595 1.04e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136513
SMART Domains Protein: ENSMUSP00000120979
Gene: ENSMUSG00000027438

DomainStartEndE-ValueType
Pfam:SNAP 8 114 3.5e-32 PFAM
Meta Mutation Damage Score 0.5502 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,884,619 H452Q probably damaging Het
Adcy8 A T 15: 64,920,680 N142K possibly damaging Het
Alkbh8 T A 9: 3,343,056 S57R probably damaging Het
Atp4a A G 7: 30,720,767 T780A probably benign Het
Atp9b A T 18: 80,917,618 probably null Het
Cdyl2 A T 8: 116,579,196 V442E probably damaging Het
Ces2a C T 8: 104,737,389 R218C possibly damaging Het
Cfap57 A T 4: 118,589,001 V688E probably damaging Het
Clec11a T C 7: 44,305,955 T139A probably benign Het
Clstn1 A T 4: 149,634,916 T411S probably benign Het
Commd5 A T 15: 76,900,624 S74C probably damaging Het
Cyp3a59 C A 5: 146,104,750 P368Q probably damaging Het
Dennd4b A G 3: 90,269,315 M309V probably benign Het
Dhrs9 T A 2: 69,401,267 V257E probably benign Het
Dhx16 T C 17: 35,891,060 V993A probably damaging Het
Dok5 A T 2: 170,870,815 Q247L probably benign Het
E330034G19Rik A T 14: 24,309,514 E331V unknown Het
Efs A G 14: 54,919,994 S287P probably benign Het
Fbn1 T C 2: 125,351,747 N1384S possibly damaging Het
Flt4 A G 11: 49,630,328 E388G possibly damaging Het
Fmn2 T A 1: 174,503,737 probably null Het
Fmo4 T C 1: 162,794,103 Y513C probably benign Het
Gbp4 T C 5: 105,119,553 E500G probably damaging Het
Gm29106 T C 1: 118,199,252 S225P probably damaging Het
Gstt2 G A 10: 75,832,520 R134W probably damaging Het
Gucy1b2 T C 14: 62,392,952 T782A probably benign Het
H2-Eb2 G A 17: 34,334,347 G169E probably damaging Het
Hdhd3 T A 4: 62,499,790 R50W probably damaging Het
Hdlbp T C 1: 93,428,222 K407E probably benign Het
Isl2 A G 9: 55,544,956 T271A probably benign Het
Kbtbd7 GTCTCTC GTC 14: 79,427,924 probably null Het
Kdm4b T A 17: 56,396,319 N671K probably damaging Het
Lats1 T A 10: 7,710,891 L939H probably damaging Het
Map3k1 A T 13: 111,756,255 M822K probably damaging Het
Mettl18 C A 1: 163,996,761 T217N probably damaging Het
Nav3 A T 10: 109,696,328 Y2083* probably null Het
Nckap1l T C 15: 103,453,806 probably benign Het
Nkx2-3 A G 19: 43,612,547 D16G probably damaging Het
Nlrx1 A G 9: 44,256,510 S697P probably benign Het
Olfr115 T C 17: 37,610,565 K62R possibly damaging Het
Olfr389 G C 11: 73,776,826 S167C probably benign Het
Olfr731 A T 14: 50,238,368 N172K probably damaging Het
Olfr790 T C 10: 129,501,706 V266A probably damaging Het
Pappa A T 4: 65,189,266 D638V probably damaging Het
Pot1a T C 6: 25,771,622 D200G probably benign Het
Ptprs G T 17: 56,419,502 T1366K probably damaging Het
Sass6 A T 3: 116,620,164 R505S probably benign Het
Slc30a6 T C 17: 74,407,238 I84T probably benign Het
Sox10 A T 15: 79,156,139 F400L probably benign Het
Spata31d1b A T 13: 59,716,909 I624F probably damaging Het
Stpg4 A G 17: 87,427,578 probably null Het
Tbc1d9 G T 8: 83,236,680 K340N probably damaging Het
Tspan12 T A 6: 21,772,683 H289L probably benign Het
Ubr1 T A 2: 120,917,828 T809S probably benign Het
Vmn1r43 C T 6: 89,870,190 V105M probably damaging Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Wnt5a A G 14: 28,518,279 probably null Het
Wwp2 T A 8: 107,517,960 S255T probably benign Het
Zbtb10 A G 3: 9,251,478 T117A possibly damaging Het
Zfp800 C T 6: 28,244,229 V246I probably benign Het
Zfp955a G T 17: 33,244,051 Y35* probably null Het
Other mutations in Gzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Gzf1 APN 2 148690996 missense probably damaging 0.99
IGL01647:Gzf1 APN 2 148683650 missense probably damaging 1.00
IGL01789:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01791:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01952:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01954:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01956:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL03391:Gzf1 APN 2 148683683 missense probably damaging 1.00
I0000:Gzf1 UTSW 2 148686620 unclassified probably benign
P0019:Gzf1 UTSW 2 148683980 missense probably damaging 1.00
R0420:Gzf1 UTSW 2 148683833 missense probably benign 0.30
R0725:Gzf1 UTSW 2 148684649 nonsense probably null
R1131:Gzf1 UTSW 2 148690867 missense probably benign 0.02
R2000:Gzf1 UTSW 2 148684611 missense probably benign 0.16
R2211:Gzf1 UTSW 2 148684950 missense probably damaging 1.00
R2251:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R2252:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R2253:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R4233:Gzf1 UTSW 2 148686533 missense possibly damaging 0.86
R5551:Gzf1 UTSW 2 148684328 missense probably damaging 1.00
R6050:Gzf1 UTSW 2 148684238 missense possibly damaging 0.89
R6891:Gzf1 UTSW 2 148684769 nonsense probably null
R7735:Gzf1 UTSW 2 148688163 missense possibly damaging 0.91
R7839:Gzf1 UTSW 2 148683895 nonsense probably null
R8168:Gzf1 UTSW 2 148684766 missense probably damaging 1.00
R8225:Gzf1 UTSW 2 148690844 missense probably benign 0.02
R8432:Gzf1 UTSW 2 148690195 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GTAATGTCAGCTGCACACAC -3'
(R):5'- AGCAGGCTACTCATCACTTACTG -3'

Sequencing Primer
(F):5'- CACAGAACTGACCTATTTCTGGTAC -3'
(R):5'- GGCTACTCATCACTTACTGAGGTATG -3'
Posted On 2019-10-07