Incidental Mutation 'R7457:Pappa'
ID578189
Institutional Source Beutler Lab
Gene Symbol Pappa
Ensembl Gene ENSMUSG00000028370
Gene Namepregnancy-associated plasma protein A
SynonymsIGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.636) question?
Stock #R7457 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location65124174-65357509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65189266 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 638 (D638V)
Ref Sequence ENSEMBL: ENSMUSP00000081545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084501]
Predicted Effect probably damaging
Transcript: ENSMUST00000084501
AA Change: D638V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: D638V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 66 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
LamGL 114 263 1.55e-54 SMART
NL 396 438 4.15e-8 SMART
NL 441 471 6.73e-1 SMART
Pfam:Peptidase_M43 500 657 2.5e-10 PFAM
Blast:FN3 669 929 1e-165 BLAST
CCP 1212 1277 1.39e-9 SMART
CCP 1282 1339 1.08e-6 SMART
CCP 1343 1407 1.64e-6 SMART
CCP 1412 1468 8.06e-6 SMART
NL 1544 1581 3.24e-10 SMART
low complexity region 1584 1591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,884,619 H452Q probably damaging Het
Adcy8 A T 15: 64,920,680 N142K possibly damaging Het
Alkbh8 T A 9: 3,343,056 S57R probably damaging Het
Atp4a A G 7: 30,720,767 T780A probably benign Het
Atp9b A T 18: 80,917,618 probably null Het
Cdyl2 A T 8: 116,579,196 V442E probably damaging Het
Ces2a C T 8: 104,737,389 R218C possibly damaging Het
Cfap57 A T 4: 118,589,001 V688E probably damaging Het
Clec11a T C 7: 44,305,955 T139A probably benign Het
Clstn1 A T 4: 149,634,916 T411S probably benign Het
Commd5 A T 15: 76,900,624 S74C probably damaging Het
Cyp3a59 C A 5: 146,104,750 P368Q probably damaging Het
Dennd4b A G 3: 90,269,315 M309V probably benign Het
Dhrs9 T A 2: 69,401,267 V257E probably benign Het
Dhx16 T C 17: 35,891,060 V993A probably damaging Het
Dok5 A T 2: 170,870,815 Q247L probably benign Het
E330034G19Rik A T 14: 24,309,514 E331V unknown Het
Efs A G 14: 54,919,994 S287P probably benign Het
Fbn1 T C 2: 125,351,747 N1384S possibly damaging Het
Flt4 A G 11: 49,630,328 E388G possibly damaging Het
Fmn2 T A 1: 174,503,737 probably null Het
Fmo4 T C 1: 162,794,103 Y513C probably benign Het
Gbp4 T C 5: 105,119,553 E500G probably damaging Het
Gm29106 T C 1: 118,199,252 S225P probably damaging Het
Gstt2 G A 10: 75,832,520 R134W probably damaging Het
Gucy1b2 T C 14: 62,392,952 T782A probably benign Het
Gzf1 G T 2: 148,690,082 R543L probably damaging Het
H2-Eb2 G A 17: 34,334,347 G169E probably damaging Het
Hdhd3 T A 4: 62,499,790 R50W probably damaging Het
Hdlbp T C 1: 93,428,222 K407E probably benign Het
Isl2 A G 9: 55,544,956 T271A probably benign Het
Kbtbd7 GTCTCTC GTC 14: 79,427,924 probably null Het
Kdm4b T A 17: 56,396,319 N671K probably damaging Het
Lats1 T A 10: 7,710,891 L939H probably damaging Het
Map3k1 A T 13: 111,756,255 M822K probably damaging Het
Mettl18 C A 1: 163,996,761 T217N probably damaging Het
Nav3 A T 10: 109,696,328 Y2083* probably null Het
Nckap1l T C 15: 103,453,806 probably benign Het
Nkx2-3 A G 19: 43,612,547 D16G probably damaging Het
Nlrx1 A G 9: 44,256,510 S697P probably benign Het
Olfr115 T C 17: 37,610,565 K62R possibly damaging Het
Olfr389 G C 11: 73,776,826 S167C probably benign Het
Olfr731 A T 14: 50,238,368 N172K probably damaging Het
Olfr790 T C 10: 129,501,706 V266A probably damaging Het
Pot1a T C 6: 25,771,622 D200G probably benign Het
Ptprs G T 17: 56,419,502 T1366K probably damaging Het
Sass6 A T 3: 116,620,164 R505S probably benign Het
Slc30a6 T C 17: 74,407,238 I84T probably benign Het
Sox10 A T 15: 79,156,139 F400L probably benign Het
Spata31d1b A T 13: 59,716,909 I624F probably damaging Het
Stpg4 A G 17: 87,427,578 probably null Het
Tbc1d9 G T 8: 83,236,680 K340N probably damaging Het
Tspan12 T A 6: 21,772,683 H289L probably benign Het
Ubr1 T A 2: 120,917,828 T809S probably benign Het
Vmn1r43 C T 6: 89,870,190 V105M probably damaging Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Wnt5a A G 14: 28,518,279 probably null Het
Wwp2 T A 8: 107,517,960 S255T probably benign Het
Zbtb10 A G 3: 9,251,478 T117A possibly damaging Het
Zfp800 C T 6: 28,244,229 V246I probably benign Het
Zfp955a G T 17: 33,244,051 Y35* probably null Het
Other mutations in Pappa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Pappa APN 4 65189316 missense probably damaging 1.00
IGL01340:Pappa APN 4 65323872 missense possibly damaging 0.49
IGL01482:Pappa APN 4 65156034 missense probably benign 0.18
IGL01485:Pappa APN 4 65189299 missense probably damaging 0.96
IGL01759:Pappa APN 4 65205158 splice site probably null
IGL01860:Pappa APN 4 65205092 missense possibly damaging 0.50
IGL01990:Pappa APN 4 65156687 splice site probably benign
IGL02089:Pappa APN 4 65156124 missense possibly damaging 0.75
IGL02153:Pappa APN 4 65297437 missense probably damaging 0.96
IGL02184:Pappa APN 4 65340691 missense possibly damaging 0.82
IGL02324:Pappa APN 4 65196808 missense probably damaging 0.99
IGL02542:Pappa APN 4 65176281 missense probably damaging 1.00
IGL02556:Pappa APN 4 65156626 missense possibly damaging 0.56
IGL02698:Pappa APN 4 65181020 missense probably damaging 1.00
IGL02903:Pappa APN 4 65261980 missense probably damaging 1.00
IGL02974:Pappa APN 4 65204935 missense probably damaging 1.00
IGL03107:Pappa APN 4 65204703 missense probably damaging 1.00
IGL03376:Pappa APN 4 65196834 missense probably benign 0.01
caer UTSW 4 65124891 missense probably damaging 0.98
Maennel UTSW 4 65314587 missense probably benign 0.05
maennelein UTSW 4 65314796 splice site probably null
mama UTSW 4 65204867 missense possibly damaging 0.94
untersuchen UTSW 4 65297257 missense probably damaging 1.00
IGL02980:Pappa UTSW 4 65307774 missense probably benign 0.25
PIT4498001:Pappa UTSW 4 65316232 missense probably damaging 1.00
R0077:Pappa UTSW 4 65307812 missense probably damaging 1.00
R0390:Pappa UTSW 4 65351613 splice site probably null
R0458:Pappa UTSW 4 65155882 missense probably damaging 1.00
R0883:Pappa UTSW 4 65189315 nonsense probably null
R0946:Pappa UTSW 4 65314792 critical splice donor site probably null
R1228:Pappa UTSW 4 65340689 missense probably damaging 1.00
R1327:Pappa UTSW 4 65351603 splice site probably benign
R1489:Pappa UTSW 4 65180948 missense possibly damaging 0.85
R1619:Pappa UTSW 4 65176229 missense probably damaging 1.00
R1856:Pappa UTSW 4 65340743 missense probably damaging 1.00
R2047:Pappa UTSW 4 65231141 splice site probably benign
R2102:Pappa UTSW 4 65316228 nonsense probably null
R2127:Pappa UTSW 4 65297257 missense probably damaging 1.00
R2143:Pappa UTSW 4 65180949 nonsense probably null
R2144:Pappa UTSW 4 65180949 nonsense probably null
R2166:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2167:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2168:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2178:Pappa UTSW 4 65351687 missense probably benign 0.00
R2504:Pappa UTSW 4 65180889 nonsense probably null
R4043:Pappa UTSW 4 65314587 missense probably benign 0.05
R4289:Pappa UTSW 4 65155863 missense probably benign 0.19
R4415:Pappa UTSW 4 65305295 missense probably benign 0.00
R4529:Pappa UTSW 4 65231182 missense probably benign
R4620:Pappa UTSW 4 65327028 missense probably benign 0.43
R4657:Pappa UTSW 4 65314796 splice site probably null
R4658:Pappa UTSW 4 65314796 splice site probably null
R5074:Pappa UTSW 4 65205128 missense probably benign 0.15
R5200:Pappa UTSW 4 65155839 missense probably damaging 1.00
R5420:Pappa UTSW 4 65335780 critical splice donor site probably null
R5469:Pappa UTSW 4 65205152 missense probably benign 0.01
R5651:Pappa UTSW 4 65156352 missense probably damaging 0.99
R5725:Pappa UTSW 4 65189410 missense probably damaging 1.00
R5941:Pappa UTSW 4 65314593 missense possibly damaging 0.52
R6002:Pappa UTSW 4 65297408 missense probably damaging 0.99
R6252:Pappa UTSW 4 65189412 missense probably benign 0.02
R6303:Pappa UTSW 4 65204654 missense probably damaging 1.00
R6322:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6431:Pappa UTSW 4 65156464 missense probably damaging 1.00
R6462:Pappa UTSW 4 65124891 missense probably damaging 0.98
R6484:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6537:Pappa UTSW 4 65297282 missense probably damaging 0.99
R6578:Pappa UTSW 4 65156137 missense possibly damaging 0.48
R6704:Pappa UTSW 4 65204924 missense probably damaging 1.00
R6789:Pappa UTSW 4 65181041 missense probably damaging 1.00
R7023:Pappa UTSW 4 65351718 missense probably benign 0.00
R7139:Pappa UTSW 4 65189450 missense probably benign 0.30
R7158:Pappa UTSW 4 65204867 missense possibly damaging 0.94
R7165:Pappa UTSW 4 65261873 missense probably damaging 1.00
R7196:Pappa UTSW 4 65323891 splice site probably null
R7410:Pappa UTSW 4 65335719 missense probably damaging 1.00
R7506:Pappa UTSW 4 65231182 missense probably benign 0.00
R7546:Pappa UTSW 4 65156115 missense possibly damaging 0.48
R7975:Pappa UTSW 4 65294468 missense probably damaging 0.96
R8111:Pappa UTSW 4 65261992 missense probably damaging 0.99
R8260:Pappa UTSW 4 65316182 missense probably damaging 0.99
R8347:Pappa UTSW 4 65327065 missense probably damaging 1.00
RF006:Pappa UTSW 4 65323873 missense probably benign 0.00
RF020:Pappa UTSW 4 65205045 missense possibly damaging 0.77
X0058:Pappa UTSW 4 65156232 missense probably damaging 1.00
X0060:Pappa UTSW 4 65124941 missense probably benign 0.00
Z1177:Pappa UTSW 4 65307758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCAGGAGTGATGACTGC -3'
(R):5'- CTTTCAAAGAAGTGGCCATCGATG -3'

Sequencing Primer
(F):5'- CCAGGAGTGATGACTGCACTAATTTG -3'
(R):5'- CCATCGATGGGTGGGAAC -3'
Posted On2019-10-07