Incidental Mutation 'R7457:Cyp3a59'
ID578193
Institutional Source Beutler Lab
Gene Symbol Cyp3a59
Ensembl Gene ENSMUSG00000061292
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 59
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7457 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location146079257-146113287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 146104750 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 368 (P368Q)
Ref Sequence ENSEMBL: ENSMUSP00000049494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035571] [ENSMUST00000199212]
Predicted Effect probably damaging
Transcript: ENSMUST00000035571
AA Change: P368Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049494
Gene: ENSMUSG00000061292
AA Change: P368Q

DomainStartEndE-ValueType
Pfam:p450 38 493 5.3e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199212
SMART Domains Protein: ENSMUSP00000142591
Gene: ENSMUSG00000061292

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:p450 38 148 3.3e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,884,619 H452Q probably damaging Het
Adcy8 A T 15: 64,920,680 N142K possibly damaging Het
Alkbh8 T A 9: 3,343,056 S57R probably damaging Het
Atp4a A G 7: 30,720,767 T780A probably benign Het
Atp9b A T 18: 80,917,618 probably null Het
Cdyl2 A T 8: 116,579,196 V442E probably damaging Het
Ces2a C T 8: 104,737,389 R218C possibly damaging Het
Cfap57 A T 4: 118,589,001 V688E probably damaging Het
Clec11a T C 7: 44,305,955 T139A probably benign Het
Clstn1 A T 4: 149,634,916 T411S probably benign Het
Commd5 A T 15: 76,900,624 S74C probably damaging Het
Dennd4b A G 3: 90,269,315 M309V probably benign Het
Dhrs9 T A 2: 69,401,267 V257E probably benign Het
Dhx16 T C 17: 35,891,060 V993A probably damaging Het
Dok5 A T 2: 170,870,815 Q247L probably benign Het
E330034G19Rik A T 14: 24,309,514 E331V unknown Het
Efs A G 14: 54,919,994 S287P probably benign Het
Fbn1 T C 2: 125,351,747 N1384S possibly damaging Het
Flt4 A G 11: 49,630,328 E388G possibly damaging Het
Fmn2 T A 1: 174,503,737 probably null Het
Fmo4 T C 1: 162,794,103 Y513C probably benign Het
Gbp4 T C 5: 105,119,553 E500G probably damaging Het
Gm29106 T C 1: 118,199,252 S225P probably damaging Het
Gstt2 G A 10: 75,832,520 R134W probably damaging Het
Gucy1b2 T C 14: 62,392,952 T782A probably benign Het
Gzf1 G T 2: 148,690,082 R543L probably damaging Het
H2-Eb2 G A 17: 34,334,347 G169E probably damaging Het
Hdhd3 T A 4: 62,499,790 R50W probably damaging Het
Hdlbp T C 1: 93,428,222 K407E probably benign Het
Isl2 A G 9: 55,544,956 T271A probably benign Het
Kbtbd7 GTCTCTC GTC 14: 79,427,924 probably null Het
Kdm4b T A 17: 56,396,319 N671K probably damaging Het
Lats1 T A 10: 7,710,891 L939H probably damaging Het
Map3k1 A T 13: 111,756,255 M822K probably damaging Het
Mettl18 C A 1: 163,996,761 T217N probably damaging Het
Nav3 A T 10: 109,696,328 Y2083* probably null Het
Nckap1l T C 15: 103,453,806 probably benign Het
Nkx2-3 A G 19: 43,612,547 D16G probably damaging Het
Nlrx1 A G 9: 44,256,510 S697P probably benign Het
Olfr115 T C 17: 37,610,565 K62R possibly damaging Het
Olfr389 G C 11: 73,776,826 S167C probably benign Het
Olfr731 A T 14: 50,238,368 N172K probably damaging Het
Olfr790 T C 10: 129,501,706 V266A probably damaging Het
Pappa A T 4: 65,189,266 D638V probably damaging Het
Pot1a T C 6: 25,771,622 D200G probably benign Het
Ptprs G T 17: 56,419,502 T1366K probably damaging Het
Sass6 A T 3: 116,620,164 R505S probably benign Het
Slc30a6 T C 17: 74,407,238 I84T probably benign Het
Sox10 A T 15: 79,156,139 F400L probably benign Het
Spata31d1b A T 13: 59,716,909 I624F probably damaging Het
Stpg4 A G 17: 87,427,578 probably null Het
Tbc1d9 G T 8: 83,236,680 K340N probably damaging Het
Tspan12 T A 6: 21,772,683 H289L probably benign Het
Ubr1 T A 2: 120,917,828 T809S probably benign Het
Vmn1r43 C T 6: 89,870,190 V105M probably damaging Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Wnt5a A G 14: 28,518,279 probably null Het
Wwp2 T A 8: 107,517,960 S255T probably benign Het
Zbtb10 A G 3: 9,251,478 T117A possibly damaging Het
Zfp800 C T 6: 28,244,229 V246I probably benign Het
Zfp955a G T 17: 33,244,051 Y35* probably null Het
Other mutations in Cyp3a59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Cyp3a59 APN 5 146102861 missense probably damaging 0.99
IGL01129:Cyp3a59 APN 5 146098279 missense probably benign 0.06
IGL01628:Cyp3a59 APN 5 146099819 missense possibly damaging 0.94
IGL01982:Cyp3a59 APN 5 146104735 missense probably benign 0.00
IGL02094:Cyp3a59 APN 5 146104821 missense probably benign 0.05
IGL02140:Cyp3a59 APN 5 146102880 missense probably damaging 1.00
IGL02350:Cyp3a59 APN 5 146079342 missense probably damaging 1.00
IGL02357:Cyp3a59 APN 5 146079342 missense probably damaging 1.00
IGL02445:Cyp3a59 APN 5 146096653 missense probably benign 0.00
IGL02681:Cyp3a59 APN 5 146090746 splice site probably benign
IGL02870:Cyp3a59 APN 5 146098184 missense probably benign
IGL03023:Cyp3a59 APN 5 146085850 missense probably benign 0.02
PIT4802001:Cyp3a59 UTSW 5 146102801 missense probably benign 0.00
R0220:Cyp3a59 UTSW 5 146098270 missense probably benign 0.02
R0532:Cyp3a59 UTSW 5 146096653 nonsense probably null
R1084:Cyp3a59 UTSW 5 146096674 missense probably benign
R1263:Cyp3a59 UTSW 5 146104711 missense probably damaging 1.00
R1573:Cyp3a59 UTSW 5 146102874 missense probably damaging 1.00
R1747:Cyp3a59 UTSW 5 146104758 missense probably benign
R1759:Cyp3a59 UTSW 5 146098250 missense probably benign 0.10
R1812:Cyp3a59 UTSW 5 146102811 missense probably damaging 1.00
R1937:Cyp3a59 UTSW 5 146094377 missense possibly damaging 0.80
R2026:Cyp3a59 UTSW 5 146096288 missense probably damaging 1.00
R2060:Cyp3a59 UTSW 5 146104714 missense probably damaging 1.00
R2355:Cyp3a59 UTSW 5 146099812 missense probably benign 0.09
R3721:Cyp3a59 UTSW 5 146096597 missense probably damaging 0.96
R4013:Cyp3a59 UTSW 5 146079383 missense probably benign 0.01
R4421:Cyp3a59 UTSW 5 146104903 splice site probably null
R4432:Cyp3a59 UTSW 5 146104786 missense probably benign 0.04
R4633:Cyp3a59 UTSW 5 146094438 missense probably damaging 1.00
R4843:Cyp3a59 UTSW 5 146096261 missense possibly damaging 0.61
R4886:Cyp3a59 UTSW 5 146087387 missense probably damaging 1.00
R5236:Cyp3a59 UTSW 5 146102825 missense probably benign 0.20
R5386:Cyp3a59 UTSW 5 146085768 missense probably benign 0.01
R5627:Cyp3a59 UTSW 5 146112854 missense probably benign 0.00
R5792:Cyp3a59 UTSW 5 146099851 missense possibly damaging 0.92
R5935:Cyp3a59 UTSW 5 146090645 nonsense probably null
R6531:Cyp3a59 UTSW 5 146098217 missense probably benign 0.00
R6790:Cyp3a59 UTSW 5 146096333 missense probably benign
R7108:Cyp3a59 UTSW 5 146096333 missense probably benign
R7222:Cyp3a59 UTSW 5 146096575 critical splice acceptor site probably null
R7447:Cyp3a59 UTSW 5 146087405 missense probably benign 0.25
R7723:Cyp3a59 UTSW 5 146079344 missense probably benign 0.06
Z1088:Cyp3a59 UTSW 5 146098222 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CCCCTAAATTGAATGTGGTCTG -3'
(R):5'- TGACTGGTTCATGGTGGAAATCC -3'

Sequencing Primer
(F):5'- ATCTGGGCAGGGGAGTATCC -3'
(R):5'- GAAATCCATTTCCAACATCTCTGTAC -3'
Posted On2019-10-07