Incidental Mutation 'R7457:Atp4a'
ID578199
Institutional Source Beutler Lab
Gene Symbol Atp4a
Ensembl Gene ENSMUSG00000005553
Gene NameATPase, H+/K+ exchanging, gastric, alpha polypeptide
SynonymsH+/K+-ATPase alpha, H+K+-transporting alpha 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7457 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30712209-30725534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30720767 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 780 (T780A)
Ref Sequence ENSEMBL: ENSMUSP00000131964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]
Predicted Effect probably benign
Transcript: ENSMUST00000005692
AA Change: T789A

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: T789A

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170371
AA Change: T780A

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: T780A

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171014
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,884,619 H452Q probably damaging Het
Adcy8 A T 15: 64,920,680 N142K possibly damaging Het
Alkbh8 T A 9: 3,343,056 S57R probably damaging Het
Atp9b A T 18: 80,917,618 probably null Het
Cdyl2 A T 8: 116,579,196 V442E probably damaging Het
Ces2a C T 8: 104,737,389 R218C possibly damaging Het
Cfap57 A T 4: 118,589,001 V688E probably damaging Het
Clec11a T C 7: 44,305,955 T139A probably benign Het
Clstn1 A T 4: 149,634,916 T411S probably benign Het
Commd5 A T 15: 76,900,624 S74C probably damaging Het
Cyp3a59 C A 5: 146,104,750 P368Q probably damaging Het
Dennd4b A G 3: 90,269,315 M309V probably benign Het
Dhrs9 T A 2: 69,401,267 V257E probably benign Het
Dhx16 T C 17: 35,891,060 V993A probably damaging Het
Dok5 A T 2: 170,870,815 Q247L probably benign Het
E330034G19Rik A T 14: 24,309,514 E331V unknown Het
Efs A G 14: 54,919,994 S287P probably benign Het
Fbn1 T C 2: 125,351,747 N1384S possibly damaging Het
Flt4 A G 11: 49,630,328 E388G possibly damaging Het
Fmn2 T A 1: 174,503,737 probably null Het
Fmo4 T C 1: 162,794,103 Y513C probably benign Het
Gbp4 T C 5: 105,119,553 E500G probably damaging Het
Gm29106 T C 1: 118,199,252 S225P probably damaging Het
Gstt2 G A 10: 75,832,520 R134W probably damaging Het
Gucy1b2 T C 14: 62,392,952 T782A probably benign Het
Gzf1 G T 2: 148,690,082 R543L probably damaging Het
H2-Eb2 G A 17: 34,334,347 G169E probably damaging Het
Hdhd3 T A 4: 62,499,790 R50W probably damaging Het
Hdlbp T C 1: 93,428,222 K407E probably benign Het
Isl2 A G 9: 55,544,956 T271A probably benign Het
Kbtbd7 GTCTCTC GTC 14: 79,427,924 probably null Het
Kdm4b T A 17: 56,396,319 N671K probably damaging Het
Lats1 T A 10: 7,710,891 L939H probably damaging Het
Map3k1 A T 13: 111,756,255 M822K probably damaging Het
Mettl18 C A 1: 163,996,761 T217N probably damaging Het
Nav3 A T 10: 109,696,328 Y2083* probably null Het
Nckap1l T C 15: 103,453,806 probably benign Het
Nkx2-3 A G 19: 43,612,547 D16G probably damaging Het
Nlrx1 A G 9: 44,256,510 S697P probably benign Het
Olfr115 T C 17: 37,610,565 K62R possibly damaging Het
Olfr389 G C 11: 73,776,826 S167C probably benign Het
Olfr731 A T 14: 50,238,368 N172K probably damaging Het
Olfr790 T C 10: 129,501,706 V266A probably damaging Het
Pappa A T 4: 65,189,266 D638V probably damaging Het
Pot1a T C 6: 25,771,622 D200G probably benign Het
Ptprs G T 17: 56,419,502 T1366K probably damaging Het
Sass6 A T 3: 116,620,164 R505S probably benign Het
Slc30a6 T C 17: 74,407,238 I84T probably benign Het
Sox10 A T 15: 79,156,139 F400L probably benign Het
Spata31d1b A T 13: 59,716,909 I624F probably damaging Het
Stpg4 A G 17: 87,427,578 probably null Het
Tbc1d9 G T 8: 83,236,680 K340N probably damaging Het
Tspan12 T A 6: 21,772,683 H289L probably benign Het
Ubr1 T A 2: 120,917,828 T809S probably benign Het
Vmn1r43 C T 6: 89,870,190 V105M probably damaging Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Wnt5a A G 14: 28,518,279 probably null Het
Wwp2 T A 8: 107,517,960 S255T probably benign Het
Zbtb10 A G 3: 9,251,478 T117A possibly damaging Het
Zfp800 C T 6: 28,244,229 V246I probably benign Het
Zfp955a G T 17: 33,244,051 Y35* probably null Het
Other mutations in Atp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Atp4a APN 7 30713204 missense possibly damaging 0.95
IGL01327:Atp4a APN 7 30713250 missense possibly damaging 0.96
IGL01510:Atp4a APN 7 30720791 missense probably benign 0.02
IGL01763:Atp4a APN 7 30715518 missense probably benign 0.20
IGL02061:Atp4a APN 7 30715029 missense probably damaging 1.00
IGL02435:Atp4a APN 7 30717057 missense probably benign
IGL02903:Atp4a APN 7 30715919 missense probably benign 0.00
IGL03181:Atp4a APN 7 30724704 missense probably benign 0.02
IGL03350:Atp4a APN 7 30720867 missense probably damaging 1.00
sublytic UTSW 7 30715800 missense probably benign 0.32
IGL03097:Atp4a UTSW 7 30723037 missense probably benign 0.14
R0095:Atp4a UTSW 7 30720735 missense probably damaging 0.99
R0121:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0140:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0241:Atp4a UTSW 7 30717135 missense probably benign 0.00
R0437:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0624:Atp4a UTSW 7 30718999 missense probably benign
R1164:Atp4a UTSW 7 30717692 missense probably benign 0.00
R2105:Atp4a UTSW 7 30720368 critical splice donor site probably null
R2272:Atp4a UTSW 7 30715500 nonsense probably null
R2327:Atp4a UTSW 7 30720241 missense probably benign 0.16
R2881:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2990:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2992:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2993:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3123:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3125:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3441:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3442:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3686:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3687:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3845:Atp4a UTSW 7 30717115 missense probably null 0.99
R4027:Atp4a UTSW 7 30724952 splice site probably null
R4072:Atp4a UTSW 7 30715332 missense probably benign 0.09
R4433:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4454:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4457:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4458:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4510:Atp4a UTSW 7 30724253 nonsense probably null
R4511:Atp4a UTSW 7 30724253 nonsense probably null
R4576:Atp4a UTSW 7 30717722 missense probably benign 0.25
R4656:Atp4a UTSW 7 30719948 intron probably benign
R4661:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4662:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4852:Atp4a UTSW 7 30724268 missense probably benign 0.10
R4892:Atp4a UTSW 7 30712474 missense probably benign 0.07
R4907:Atp4a UTSW 7 30719092 missense possibly damaging 0.66
R5024:Atp4a UTSW 7 30715864 missense possibly damaging 0.82
R5254:Atp4a UTSW 7 30715530 missense probably damaging 1.00
R5318:Atp4a UTSW 7 30715329 missense probably damaging 1.00
R5340:Atp4a UTSW 7 30720806 missense probably benign
R5484:Atp4a UTSW 7 30720672 unclassified probably benign
R5729:Atp4a UTSW 7 30712426 missense possibly damaging 0.48
R5762:Atp4a UTSW 7 30719096 missense probably damaging 0.99
R5797:Atp4a UTSW 7 30712649 missense probably damaging 1.00
R6030:Atp4a UTSW 7 30722516 missense probably damaging 0.99
R6030:Atp4a UTSW 7 30722516 missense probably damaging 0.99
R6077:Atp4a UTSW 7 30715919 missense probably benign 0.00
R6243:Atp4a UTSW 7 30715957 missense possibly damaging 0.68
R6346:Atp4a UTSW 7 30715356 missense possibly damaging 0.84
R6459:Atp4a UTSW 7 30712462 missense probably benign 0.00
R6515:Atp4a UTSW 7 30712478 missense possibly damaging 0.78
R6773:Atp4a UTSW 7 30715377 missense probably damaging 0.98
R6854:Atp4a UTSW 7 30715008 missense probably benign 0.29
R7215:Atp4a UTSW 7 30717360 missense possibly damaging 0.61
R7271:Atp4a UTSW 7 30722519 missense probably benign 0.16
R7340:Atp4a UTSW 7 30716730 missense possibly damaging 0.94
R7593:Atp4a UTSW 7 30724680 missense probably benign 0.08
R7712:Atp4a UTSW 7 30715553 missense probably damaging 0.96
R7762:Atp4a UTSW 7 30720036 missense probably damaging 0.96
Z1177:Atp4a UTSW 7 30717840 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AAAGCTGACATTGGTGTAGCC -3'
(R):5'- TTTGTGTCCCTCCATGAGTG -3'

Sequencing Primer
(F):5'- CTCGGATGCTGCTAAAAATGCTG -3'
(R):5'- TCCATGAGTGTGGAGGGCAC -3'
Posted On2019-10-07