Incidental Mutation 'R7457:Clec11a'
ID578200
Institutional Source Beutler Lab
Gene Symbol Clec11a
Ensembl Gene ENSMUSG00000004473
Gene NameC-type lectin domain family 11, member a
SynonymsClecsf3, Scgf
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7457 (G1)
Quality Score201.009
Status Not validated
Chromosome7
Chromosomal Location44302687-44306902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44305955 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 139 (T139A)
Ref Sequence ENSEMBL: ENSMUSP00000004587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004587] [ENSMUST00000107938]
Predicted Effect probably benign
Transcript: ENSMUST00000004587
AA Change: T139A

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000004587
Gene: ENSMUSG00000004473
AA Change: T139A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 109 N/A INTRINSIC
CLECT 182 325 1.7e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107938
SMART Domains Protein: ENSMUSP00000103571
Gene: ENSMUSG00000038738

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
Pfam:FERM_f0 73 156 6.6e-17 PFAM
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 804 839 5e-11 BLAST
low complexity region 929 950 N/A INTRINSIC
low complexity region 964 991 N/A INTRINSIC
low complexity region 1002 1032 N/A INTRINSIC
low complexity region 1060 1089 N/A INTRINSIC
low complexity region 1132 1147 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1188 1229 N/A INTRINSIC
low complexity region 1265 1284 N/A INTRINSIC
low complexity region 1307 1332 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1378 1413 N/A INTRINSIC
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 1521 1541 N/A INTRINSIC
low complexity region 1548 1564 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
low complexity region 1589 1623 N/A INTRINSIC
low complexity region 1642 1676 N/A INTRINSIC
low complexity region 1694 1729 N/A INTRINSIC
low complexity region 1744 1755 N/A INTRINSIC
low complexity region 1785 1796 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1843 1861 N/A INTRINSIC
low complexity region 1902 1916 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
low complexity region 1951 1985 N/A INTRINSIC
low complexity region 1997 2013 N/A INTRINSIC
low complexity region 2018 2038 N/A INTRINSIC
low complexity region 2068 2092 N/A INTRINSIC
SAM 2101 2167 1.35e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin superfamily. The encoded protein is a secreted sulfated glycoprotein and functions as a growth factor for primitive hematopoietic progenitor cells. An alternative splice variant has been described but its biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bone volume in limb bones and vertebrae, reduced bone strength, and delayed fracture healing. Bone marrow stromal cells display impaired osteogenic differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,884,619 H452Q probably damaging Het
Adcy8 A T 15: 64,920,680 N142K possibly damaging Het
Alkbh8 T A 9: 3,343,056 S57R probably damaging Het
Atp4a A G 7: 30,720,767 T780A probably benign Het
Cdyl2 A T 8: 116,579,196 V442E probably damaging Het
Ces2a C T 8: 104,737,389 R218C possibly damaging Het
Cfap57 A T 4: 118,589,001 V688E probably damaging Het
Clstn1 A T 4: 149,634,916 T411S probably benign Het
Commd5 A T 15: 76,900,624 S74C probably damaging Het
Cyp3a59 C A 5: 146,104,750 P368Q probably damaging Het
Dennd4b A G 3: 90,269,315 M309V probably benign Het
Dhrs9 T A 2: 69,401,267 V257E probably benign Het
Dhx16 T C 17: 35,891,060 V993A probably damaging Het
Dok5 A T 2: 170,870,815 Q247L probably benign Het
E330034G19Rik A T 14: 24,309,514 E331V unknown Het
Efs A G 14: 54,919,994 S287P probably benign Het
Fbn1 T C 2: 125,351,747 N1384S possibly damaging Het
Flt4 A G 11: 49,630,328 E388G possibly damaging Het
Fmo4 T C 1: 162,794,103 Y513C probably benign Het
Gbp4 T C 5: 105,119,553 E500G probably damaging Het
Gm29106 T C 1: 118,199,252 S225P probably damaging Het
Gstt2 G A 10: 75,832,520 R134W probably damaging Het
Gucy1b2 T C 14: 62,392,952 T782A probably benign Het
Gzf1 G T 2: 148,690,082 R543L probably damaging Het
H2-Eb2 G A 17: 34,334,347 G169E probably damaging Het
Hdhd3 T A 4: 62,499,790 R50W probably damaging Het
Hdlbp T C 1: 93,428,222 K407E probably benign Het
Isl2 A G 9: 55,544,956 T271A probably benign Het
Kbtbd7 GTCTCTC GTC 14: 79,427,924 probably null Het
Kdm4b T A 17: 56,396,319 N671K probably damaging Het
Lats1 T A 10: 7,710,891 L939H probably damaging Het
Map3k1 A T 13: 111,756,255 M822K probably damaging Het
Mettl18 C A 1: 163,996,761 T217N probably damaging Het
Nav3 A T 10: 109,696,328 Y2083* probably null Het
Nkx2-3 A G 19: 43,612,547 D16G probably damaging Het
Nlrx1 A G 9: 44,256,510 S697P probably benign Het
Olfr115 T C 17: 37,610,565 K62R possibly damaging Het
Olfr389 G C 11: 73,776,826 S167C probably benign Het
Olfr731 A T 14: 50,238,368 N172K probably damaging Het
Olfr790 T C 10: 129,501,706 V266A probably damaging Het
Pappa A T 4: 65,189,266 D638V probably damaging Het
Pot1a T C 6: 25,771,622 D200G probably benign Het
Ptprs G T 17: 56,419,502 T1366K probably damaging Het
Sass6 A T 3: 116,620,164 R505S probably benign Het
Slc30a6 T C 17: 74,407,238 I84T probably benign Het
Sox10 A T 15: 79,156,139 F400L probably benign Het
Spata31d1b A T 13: 59,716,909 I624F probably damaging Het
Stpg4 A G 17: 87,427,578 probably null Het
Tbc1d9 G T 8: 83,236,680 K340N probably damaging Het
Tspan12 T A 6: 21,772,683 H289L probably benign Het
Ubr1 T A 2: 120,917,828 T809S probably benign Het
Vmn1r43 C T 6: 89,870,190 V105M probably damaging Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Wwp2 T A 8: 107,517,960 S255T probably benign Het
Zbtb10 A G 3: 9,251,478 T117A possibly damaging Het
Zfp800 C T 6: 28,244,229 V246I probably benign Het
Zfp955a G T 17: 33,244,051 Y35* probably null Het
Other mutations in Clec11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0038:Clec11a UTSW 7 44306482 unclassified probably benign
R0038:Clec11a UTSW 7 44306482 unclassified probably benign
R1456:Clec11a UTSW 7 44306450 missense possibly damaging 0.63
R1944:Clec11a UTSW 7 44304674 missense probably benign 0.01
R5093:Clec11a UTSW 7 44304726 missense probably damaging 1.00
R5138:Clec11a UTSW 7 44304638 missense probably benign
R5642:Clec11a UTSW 7 44306408 missense possibly damaging 0.76
R6126:Clec11a UTSW 7 44304921 missense probably damaging 0.99
R7513:Clec11a UTSW 7 44306356 missense probably benign 0.34
X0017:Clec11a UTSW 7 44305838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTCTATGTGGACCCTCTG -3'
(R):5'- AGATCGCCTCATCCAATCCG -3'

Sequencing Primer
(F):5'- GTATCCTGATACCCGTTTTCTCCAGG -3'
(R):5'- ATCCAATCCGCTTTTGGGAG -3'
Posted On2019-10-07