Incidental Mutation 'R7457:Ces2a'
ID 578203
Institutional Source Beutler Lab
Gene Symbol Ces2a
Ensembl Gene ENSMUSG00000055730
Gene Name carboxylesterase 2A
Synonyms 9130231C15Rik, Ces6
MMRRC Submission 045531-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R7457 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 105460635-105468266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 105464021 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 218 (R218C)
Ref Sequence ENSEMBL: ENSMUSP00000034346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034346] [ENSMUST00000161824] [ENSMUST00000164182]
AlphaFold Q8QZR3
Predicted Effect possibly damaging
Transcript: ENSMUST00000034346
AA Change: R218C

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034346
Gene: ENSMUSG00000055730
AA Change: R218C

DomainStartEndE-ValueType
Pfam:COesterase 9 537 1.2e-171 PFAM
Pfam:Abhydrolase_3 142 267 2.9e-11 PFAM
Pfam:Peptidase_S9 156 347 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159303
Predicted Effect probably benign
Transcript: ENSMUST00000161824
Predicted Effect possibly damaging
Transcript: ENSMUST00000164182
AA Change: R218C

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127346
Gene: ENSMUSG00000055730
AA Change: R218C

DomainStartEndE-ValueType
Pfam:COesterase 8 276 5e-110 PFAM
Pfam:Abhydrolase_3 142 267 2.6e-11 PFAM
Pfam:Peptidase_S9 156 275 3e-7 PFAM
Pfam:COesterase 259 504 8.3e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 25,374,635 (GRCm39) H452Q probably damaging Het
Adcy8 A T 15: 64,792,529 (GRCm39) N142K possibly damaging Het
Alkbh8 T A 9: 3,343,056 (GRCm39) S57R probably damaging Het
Atp4a A G 7: 30,420,192 (GRCm39) T780A probably benign Het
Atp9b A T 18: 80,960,833 (GRCm39) probably null Het
Cdyl2 A T 8: 117,305,935 (GRCm39) V442E probably damaging Het
Cfap57 A T 4: 118,446,198 (GRCm39) V688E probably damaging Het
Clec11a T C 7: 43,955,379 (GRCm39) T139A probably benign Het
Clstn1 A T 4: 149,719,373 (GRCm39) T411S probably benign Het
Commd5 A T 15: 76,784,824 (GRCm39) S74C probably damaging Het
Cyp3a59 C A 5: 146,041,560 (GRCm39) P368Q probably damaging Het
Dennd4b A G 3: 90,176,622 (GRCm39) M309V probably benign Het
Dhrs9 T A 2: 69,231,611 (GRCm39) V257E probably benign Het
Dhx16 T C 17: 36,201,952 (GRCm39) V993A probably damaging Het
Dok5 A T 2: 170,712,735 (GRCm39) Q247L probably benign Het
E330034G19Rik A T 14: 24,359,582 (GRCm39) E331V unknown Het
Efs A G 14: 55,157,451 (GRCm39) S287P probably benign Het
Fbn1 T C 2: 125,193,667 (GRCm39) N1384S possibly damaging Het
Flt4 A G 11: 49,521,155 (GRCm39) E388G possibly damaging Het
Fmn2 T A 1: 174,331,303 (GRCm39) probably null Het
Fmo4 T C 1: 162,621,672 (GRCm39) Y513C probably benign Het
Gbp4 T C 5: 105,267,419 (GRCm39) E500G probably damaging Het
Gm29106 T C 1: 118,126,982 (GRCm39) S225P probably damaging Het
Gstt2 G A 10: 75,668,354 (GRCm39) R134W probably damaging Het
Gucy1b2 T C 14: 62,630,401 (GRCm39) T782A probably benign Het
Gzf1 G T 2: 148,532,002 (GRCm39) R543L probably damaging Het
H2-Eb2 G A 17: 34,553,321 (GRCm39) G169E probably damaging Het
Hdhd3 T A 4: 62,418,027 (GRCm39) R50W probably damaging Het
Hdlbp T C 1: 93,355,944 (GRCm39) K407E probably benign Het
Isl2 A G 9: 55,452,240 (GRCm39) T271A probably benign Het
Kbtbd7 GTCTCTC GTC 14: 79,665,364 (GRCm39) probably null Het
Kdm4b T A 17: 56,703,319 (GRCm39) N671K probably damaging Het
Lats1 T A 10: 7,586,655 (GRCm39) L939H probably damaging Het
Map3k1 A T 13: 111,892,789 (GRCm39) M822K probably damaging Het
Mettl18 C A 1: 163,824,330 (GRCm39) T217N probably damaging Het
Nav3 A T 10: 109,532,189 (GRCm39) Y2083* probably null Het
Nckap1l T C 15: 103,362,233 (GRCm39) probably benign Het
Nkx2-3 A G 19: 43,600,986 (GRCm39) D16G probably damaging Het
Nlrx1 A G 9: 44,167,807 (GRCm39) S697P probably benign Het
Or14j4 T C 17: 37,921,456 (GRCm39) K62R possibly damaging Het
Or1e29 G C 11: 73,667,652 (GRCm39) S167C probably benign Het
Or4k6 A T 14: 50,475,825 (GRCm39) N172K probably damaging Het
Or6c75 T C 10: 129,337,575 (GRCm39) V266A probably damaging Het
Pappa A T 4: 65,107,503 (GRCm39) D638V probably damaging Het
Pot1a T C 6: 25,771,621 (GRCm39) D200G probably benign Het
Ptprs G T 17: 56,726,502 (GRCm39) T1366K probably damaging Het
Sass6 A T 3: 116,413,813 (GRCm39) R505S probably benign Het
Slc30a6 T C 17: 74,714,233 (GRCm39) I84T probably benign Het
Sox10 A T 15: 79,040,339 (GRCm39) F400L probably benign Het
Spata31d1b A T 13: 59,864,723 (GRCm39) I624F probably damaging Het
Stpg4 A G 17: 87,735,006 (GRCm39) probably null Het
Tbc1d9 G T 8: 83,963,309 (GRCm39) K340N probably damaging Het
Tspan12 T A 6: 21,772,682 (GRCm39) H289L probably benign Het
Ubr1 T A 2: 120,748,309 (GRCm39) T809S probably benign Het
Vmn1r43 C T 6: 89,847,172 (GRCm39) V105M probably damaging Het
Vmn1r49 A G 6: 90,049,534 (GRCm39) V156A probably benign Het
Wnt5a A G 14: 28,240,236 (GRCm39) probably null Het
Wwp2 T A 8: 108,244,592 (GRCm39) S255T probably benign Het
Zbtb10 A G 3: 9,316,538 (GRCm39) T117A possibly damaging Het
Zfp800 C T 6: 28,244,228 (GRCm39) V246I probably benign Het
Zfp955a G T 17: 33,463,025 (GRCm39) Y35* probably null Het
Other mutations in Ces2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ces2a APN 8 105,468,047 (GRCm39) makesense probably null
IGL02135:Ces2a APN 8 105,466,813 (GRCm39) missense probably benign 0.00
IGL02529:Ces2a APN 8 105,463,851 (GRCm39) splice site probably benign
IGL02625:Ces2a APN 8 105,466,910 (GRCm39) critical splice donor site probably null
IGL02869:Ces2a APN 8 105,465,691 (GRCm39) missense probably damaging 1.00
IGL03265:Ces2a APN 8 105,464,075 (GRCm39) missense possibly damaging 0.55
IGL03349:Ces2a APN 8 105,460,712 (GRCm39) missense probably damaging 0.99
R0010:Ces2a UTSW 8 105,468,028 (GRCm39) missense probably benign 0.00
R0318:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 1.00
R0477:Ces2a UTSW 8 105,464,169 (GRCm39) missense probably damaging 0.99
R0561:Ces2a UTSW 8 105,464,165 (GRCm39) missense probably benign 0.35
R0619:Ces2a UTSW 8 105,462,742 (GRCm39) missense probably benign 0.00
R1665:Ces2a UTSW 8 105,464,187 (GRCm39) splice site probably benign
R1737:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 0.98
R2266:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2267:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2269:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2288:Ces2a UTSW 8 105,464,069 (GRCm39) missense probably damaging 1.00
R2656:Ces2a UTSW 8 105,462,766 (GRCm39) missense probably benign 0.00
R3176:Ces2a UTSW 8 105,466,010 (GRCm39) splice site probably benign
R3906:Ces2a UTSW 8 105,465,940 (GRCm39) missense probably benign 0.00
R4344:Ces2a UTSW 8 105,463,766 (GRCm39) missense probably damaging 1.00
R4708:Ces2a UTSW 8 105,463,938 (GRCm39) missense probably benign 0.14
R4780:Ces2a UTSW 8 105,463,840 (GRCm39) missense probably damaging 1.00
R5434:Ces2a UTSW 8 105,464,041 (GRCm39) missense probably damaging 0.98
R5763:Ces2a UTSW 8 105,462,756 (GRCm39) missense probably benign 0.00
R5828:Ces2a UTSW 8 105,465,956 (GRCm39) missense probably benign 0.00
R6359:Ces2a UTSW 8 105,462,710 (GRCm39) missense probably benign 0.00
R6440:Ces2a UTSW 8 105,467,954 (GRCm39) missense probably benign 0.12
R7066:Ces2a UTSW 8 105,466,880 (GRCm39) missense probably damaging 0.99
R7267:Ces2a UTSW 8 105,465,672 (GRCm39) missense probably benign 0.20
R7395:Ces2a UTSW 8 105,466,273 (GRCm39) missense probably benign 0.35
R7455:Ces2a UTSW 8 105,464,154 (GRCm39) missense probably damaging 1.00
R7567:Ces2a UTSW 8 105,467,930 (GRCm39) missense probably benign 0.01
R7683:Ces2a UTSW 8 105,463,744 (GRCm39) missense probably benign 0.00
R8328:Ces2a UTSW 8 105,463,998 (GRCm39) missense probably damaging 1.00
R8336:Ces2a UTSW 8 105,465,665 (GRCm39) missense probably damaging 0.97
R9183:Ces2a UTSW 8 105,460,774 (GRCm39) missense possibly damaging 0.95
R9794:Ces2a UTSW 8 105,467,896 (GRCm39) missense probably benign 0.16
X0022:Ces2a UTSW 8 105,462,774 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,461,482 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,460,638 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCGCCATCCAGTATCGCTTG -3'
(R):5'- TAGCAAAGTAGGGGCTGTTG -3'

Sequencing Primer
(F):5'- TGGCTTCTTCAGGTAAGCC -3'
(R):5'- GTTCTTGGGGGCACTTACC -3'
Posted On 2019-10-07