Incidental Mutation 'R7457:Nlrx1'
ID578207
Institutional Source Beutler Lab
Gene Symbol Nlrx1
Ensembl Gene ENSMUSG00000032109
Gene NameNLR family member X1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R7457 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location44252717-44268599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44256510 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 697 (S697P)
Ref Sequence ENSEMBL: ENSMUSP00000034621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034621] [ENSMUST00000168499] [ENSMUST00000169651]
Predicted Effect probably benign
Transcript: ENSMUST00000034621
AA Change: S697P

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034621
Gene: ENSMUSG00000032109
AA Change: S697P

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.1e-22 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168499
AA Change: S697P

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127531
Gene: ENSMUSG00000032109
AA Change: S697P

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169651
AA Change: S697P

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126555
Gene: ENSMUSG00000032109
AA Change: S697P

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the NLR family and localizes to the outer mitochondrial membrane. The encoded protein is a regulator of mitochondrial antivirus responses. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,884,619 H452Q probably damaging Het
Adcy8 A T 15: 64,920,680 N142K possibly damaging Het
Alkbh8 T A 9: 3,343,056 S57R probably damaging Het
Atp4a A G 7: 30,720,767 T780A probably benign Het
Atp9b A T 18: 80,917,618 probably null Het
Cdyl2 A T 8: 116,579,196 V442E probably damaging Het
Ces2a C T 8: 104,737,389 R218C possibly damaging Het
Cfap57 A T 4: 118,589,001 V688E probably damaging Het
Clec11a T C 7: 44,305,955 T139A probably benign Het
Clstn1 A T 4: 149,634,916 T411S probably benign Het
Commd5 A T 15: 76,900,624 S74C probably damaging Het
Cyp3a59 C A 5: 146,104,750 P368Q probably damaging Het
Dennd4b A G 3: 90,269,315 M309V probably benign Het
Dhrs9 T A 2: 69,401,267 V257E probably benign Het
Dhx16 T C 17: 35,891,060 V993A probably damaging Het
Dok5 A T 2: 170,870,815 Q247L probably benign Het
E330034G19Rik A T 14: 24,309,514 E331V unknown Het
Efs A G 14: 54,919,994 S287P probably benign Het
Fbn1 T C 2: 125,351,747 N1384S possibly damaging Het
Flt4 A G 11: 49,630,328 E388G possibly damaging Het
Fmn2 T A 1: 174,503,737 probably null Het
Fmo4 T C 1: 162,794,103 Y513C probably benign Het
Gbp4 T C 5: 105,119,553 E500G probably damaging Het
Gm29106 T C 1: 118,199,252 S225P probably damaging Het
Gstt2 G A 10: 75,832,520 R134W probably damaging Het
Gucy1b2 T C 14: 62,392,952 T782A probably benign Het
Gzf1 G T 2: 148,690,082 R543L probably damaging Het
H2-Eb2 G A 17: 34,334,347 G169E probably damaging Het
Hdhd3 T A 4: 62,499,790 R50W probably damaging Het
Hdlbp T C 1: 93,428,222 K407E probably benign Het
Isl2 A G 9: 55,544,956 T271A probably benign Het
Kbtbd7 GTCTCTC GTC 14: 79,427,924 probably null Het
Kdm4b T A 17: 56,396,319 N671K probably damaging Het
Lats1 T A 10: 7,710,891 L939H probably damaging Het
Map3k1 A T 13: 111,756,255 M822K probably damaging Het
Mettl18 C A 1: 163,996,761 T217N probably damaging Het
Nav3 A T 10: 109,696,328 Y2083* probably null Het
Nckap1l T C 15: 103,453,806 probably benign Het
Nkx2-3 A G 19: 43,612,547 D16G probably damaging Het
Olfr115 T C 17: 37,610,565 K62R possibly damaging Het
Olfr389 G C 11: 73,776,826 S167C probably benign Het
Olfr731 A T 14: 50,238,368 N172K probably damaging Het
Olfr790 T C 10: 129,501,706 V266A probably damaging Het
Pappa A T 4: 65,189,266 D638V probably damaging Het
Pot1a T C 6: 25,771,622 D200G probably benign Het
Ptprs G T 17: 56,419,502 T1366K probably damaging Het
Sass6 A T 3: 116,620,164 R505S probably benign Het
Slc30a6 T C 17: 74,407,238 I84T probably benign Het
Sox10 A T 15: 79,156,139 F400L probably benign Het
Spata31d1b A T 13: 59,716,909 I624F probably damaging Het
Stpg4 A G 17: 87,427,578 probably null Het
Tbc1d9 G T 8: 83,236,680 K340N probably damaging Het
Tspan12 T A 6: 21,772,683 H289L probably benign Het
Ubr1 T A 2: 120,917,828 T809S probably benign Het
Vmn1r43 C T 6: 89,870,190 V105M probably damaging Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Wnt5a A G 14: 28,518,279 probably null Het
Wwp2 T A 8: 107,517,960 S255T probably benign Het
Zbtb10 A G 3: 9,251,478 T117A possibly damaging Het
Zfp800 C T 6: 28,244,229 V246I probably benign Het
Zfp955a G T 17: 33,244,051 Y35* probably null Het
Other mutations in Nlrx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nlrx1 APN 9 44253279 missense probably damaging 0.96
IGL00233:Nlrx1 APN 9 44264068 missense probably benign 0.37
IGL02388:Nlrx1 APN 9 44264005 missense probably benign 0.09
IGL02450:Nlrx1 APN 9 44253501 missense probably benign
IGL03353:Nlrx1 APN 9 44256593 missense probably benign
R0180:Nlrx1 UTSW 9 44255459 missense possibly damaging 0.95
R0416:Nlrx1 UTSW 9 44262914 missense probably benign
R1478:Nlrx1 UTSW 9 44264077 missense probably benign 0.04
R1762:Nlrx1 UTSW 9 44263640 missense possibly damaging 0.49
R1921:Nlrx1 UTSW 9 44254134 nonsense probably null
R1972:Nlrx1 UTSW 9 44253456 missense probably benign 0.01
R2050:Nlrx1 UTSW 9 44262780 missense probably damaging 1.00
R2100:Nlrx1 UTSW 9 44262608 missense probably damaging 1.00
R3967:Nlrx1 UTSW 9 44255425 splice site probably benign
R3968:Nlrx1 UTSW 9 44255425 splice site probably benign
R3969:Nlrx1 UTSW 9 44255425 splice site probably benign
R4898:Nlrx1 UTSW 9 44256897 missense probably benign
R4951:Nlrx1 UTSW 9 44253429 missense possibly damaging 0.81
R4956:Nlrx1 UTSW 9 44262612 nonsense probably null
R4959:Nlrx1 UTSW 9 44254151 missense possibly damaging 0.79
R5235:Nlrx1 UTSW 9 44263750 missense probably damaging 0.99
R5536:Nlrx1 UTSW 9 44263886 missense probably damaging 1.00
R6030:Nlrx1 UTSW 9 44263760 missense probably damaging 1.00
R6030:Nlrx1 UTSW 9 44263760 missense probably damaging 1.00
R6698:Nlrx1 UTSW 9 44265807 missense probably damaging 1.00
R7130:Nlrx1 UTSW 9 44262341 missense possibly damaging 0.83
R7253:Nlrx1 UTSW 9 44264704 splice site probably null
R7863:Nlrx1 UTSW 9 44265212 missense probably benign
R7946:Nlrx1 UTSW 9 44265212 missense probably benign
X0023:Nlrx1 UTSW 9 44256563 missense probably damaging 1.00
Z1176:Nlrx1 UTSW 9 44256923 missense not run
Z1177:Nlrx1 UTSW 9 44256752 missense not run
Predicted Primers PCR Primer
(F):5'- GACTAGTGCTCACCCCAGTTTC -3'
(R):5'- ATGTTCATGGGCGGACTTCTC -3'

Sequencing Primer
(F):5'- AGTTTCCGGGCACGCAG -3'
(R):5'- ATGGGCGGACTTCTCTCTGC -3'
Posted On2019-10-07