Mutagenetix > Incidental Mutation

Incidental Mutation 'R7457:Lats1'

578209

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

045531-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R7457 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 7710891 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 939 (L939H)

Ref Sequence

ENSEMBL: ENSMUSP00000132078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably damaging
Transcript: ENSMUST00000040043
AA Change: L939H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: L939H

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165952
AA Change: L939H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: L939H

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000217931
AA Change: L939H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam32	A	T	8: 24,884,619	H452Q	probably damaging	Het
Adcy8	A	T	15: 64,920,680	N142K	possibly damaging	Het
Alkbh8	T	A	9: 3,343,056	S57R	probably damaging	Het
Atp4a	A	G	7: 30,720,767	T780A	probably benign	Het
Atp9b	A	T	18: 80,917,618		probably null	Het
Cdyl2	A	T	8: 116,579,196	V442E	probably damaging	Het
Ces2a	C	T	8: 104,737,389	R218C	possibly damaging	Het
Cfap57	A	T	4: 118,589,001	V688E	probably damaging	Het
Clec11a	T	C	7: 44,305,955	T139A	probably benign	Het
Clstn1	A	T	4: 149,634,916	T411S	probably benign	Het
Commd5	A	T	15: 76,900,624	S74C	probably damaging	Het
Cyp3a59	C	A	5: 146,104,750	P368Q	probably damaging	Het
Dennd4b	A	G	3: 90,269,315	M309V	probably benign	Het
Dhrs9	T	A	2: 69,401,267	V257E	probably benign	Het
Dhx16	T	C	17: 35,891,060	V993A	probably damaging	Het
Dok5	A	T	2: 170,870,815	Q247L	probably benign	Het
E330034G19Rik	A	T	14: 24,309,514	E331V	unknown	Het
Efs	A	G	14: 54,919,994	S287P	probably benign	Het
Fbn1	T	C	2: 125,351,747	N1384S	possibly damaging	Het
Flt4	A	G	11: 49,630,328	E388G	possibly damaging	Het
Fmn2	T	A	1: 174,503,737		probably null	Het
Fmo4	T	C	1: 162,794,103	Y513C	probably benign	Het
Gbp4	T	C	5: 105,119,553	E500G	probably damaging	Het
Gm29106	T	C	1: 118,199,252	S225P	probably damaging	Het
Gstt2	G	A	10: 75,832,520	R134W	probably damaging	Het
Gucy1b2	T	C	14: 62,392,952	T782A	probably benign	Het
Gzf1	G	T	2: 148,690,082	R543L	probably damaging	Het
H2-Eb2	G	A	17: 34,334,347	G169E	probably damaging	Het
Hdhd3	T	A	4: 62,499,790	R50W	probably damaging	Het
Hdlbp	T	C	1: 93,428,222	K407E	probably benign	Het
Isl2	A	G	9: 55,544,956	T271A	probably benign	Het
Kbtbd7	GTCTCTC	GTC	14: 79,427,924		probably null	Het
Kdm4b	T	A	17: 56,396,319	N671K	probably damaging	Het
Map3k1	A	T	13: 111,756,255	M822K	probably damaging	Het
Mettl18	C	A	1: 163,996,761	T217N	probably damaging	Het
Nav3	A	T	10: 109,696,328	Y2083*	probably null	Het
Nckap1l	T	C	15: 103,453,806		probably benign	Het
Nkx2-3	A	G	19: 43,612,547	D16G	probably damaging	Het
Nlrx1	A	G	9: 44,256,510	S697P	probably benign	Het
Olfr115	T	C	17: 37,610,565	K62R	possibly damaging	Het
Olfr389	G	C	11: 73,776,826	S167C	probably benign	Het
Olfr731	A	T	14: 50,238,368	N172K	probably damaging	Het
Olfr790	T	C	10: 129,501,706	V266A	probably damaging	Het
Pappa	A	T	4: 65,189,266	D638V	probably damaging	Het
Pot1a	T	C	6: 25,771,622	D200G	probably benign	Het
Ptprs	G	T	17: 56,419,502	T1366K	probably damaging	Het
Sass6	A	T	3: 116,620,164	R505S	probably benign	Het
Slc30a6	T	C	17: 74,407,238	I84T	probably benign	Het
Sox10	A	T	15: 79,156,139	F400L	probably benign	Het
Spata31d1b	A	T	13: 59,716,909	I624F	probably damaging	Het
Stpg4	A	G	17: 87,427,578		probably null	Het
Tbc1d9	G	T	8: 83,236,680	K340N	probably damaging	Het
Tspan12	T	A	6: 21,772,683	H289L	probably benign	Het
Ubr1	T	A	2: 120,917,828	T809S	probably benign	Het
Vmn1r43	C	T	6: 89,870,190	V105M	probably damaging	Het
Vmn1r49	A	G	6: 90,072,552	V156A	probably benign	Het
Wnt5a	A	G	14: 28,518,279		probably null	Het
Wwp2	T	A	8: 107,517,960	S255T	probably benign	Het
Zbtb10	A	G	3: 9,251,478	T117A	possibly damaging	Het
Zfp800	C	T	6: 28,244,229	V246I	probably benign	Het
Zfp955a	G	T	17: 33,244,051	Y35*	probably null	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGAAGTGCTACTGCGAAC -3'
(R):5'- GTGAATGGAATACTTCTGTCTCAAG -3'

Sequencing Primer
(F):5'- CAGTAGTATTTTAAAGCAGCCAACC -3'
(R):5'- CTGTCTCAAGTGTTTCAGGAAAGAC -3'

Posted On

2019-10-07