Incidental Mutation 'R7457:Efs'
ID578219
Institutional Source Beutler Lab
Gene Symbol Efs
Ensembl Gene ENSMUSG00000022203
Gene Nameembryonal Fyn-associated substrate
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R7457 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54916535-54926126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54919994 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 287 (S287P)
Ref Sequence ENSEMBL: ENSMUSP00000022813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022813] [ENSMUST00000227037] [ENSMUST00000227587]
Predicted Effect probably benign
Transcript: ENSMUST00000022813
AA Change: S287P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022813
Gene: ENSMUSG00000022203
AA Change: S287P

DomainStartEndE-ValueType
SH3 8 67 5.15e-19 SMART
low complexity region 201 215 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 305 325 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Pfam:DUF3513 370 555 9.2e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227037
AA Change: S194P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227587
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The longest protein isoform encoded by this gene contains an SH3 domain, which is known to be important in intracellular signal transduction. The protein encoded by a similiar gene in mice was shown to bind to SH3 domains of protein-tyrosine kinases. The function of this gene is unknown. Three alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display an increased inflammatory response characterized by excessive T cell responses, enhanced cytokine secretion and antibody production, and intestinal, kidney, liver, and lung inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,884,619 H452Q probably damaging Het
Adcy8 A T 15: 64,920,680 N142K possibly damaging Het
Alkbh8 T A 9: 3,343,056 S57R probably damaging Het
Atp4a A G 7: 30,720,767 T780A probably benign Het
Atp9b A T 18: 80,917,618 probably null Het
Cdyl2 A T 8: 116,579,196 V442E probably damaging Het
Ces2a C T 8: 104,737,389 R218C possibly damaging Het
Cfap57 A T 4: 118,589,001 V688E probably damaging Het
Clec11a T C 7: 44,305,955 T139A probably benign Het
Clstn1 A T 4: 149,634,916 T411S probably benign Het
Commd5 A T 15: 76,900,624 S74C probably damaging Het
Cyp3a59 C A 5: 146,104,750 P368Q probably damaging Het
Dennd4b A G 3: 90,269,315 M309V probably benign Het
Dhrs9 T A 2: 69,401,267 V257E probably benign Het
Dhx16 T C 17: 35,891,060 V993A probably damaging Het
Dok5 A T 2: 170,870,815 Q247L probably benign Het
E330034G19Rik A T 14: 24,309,514 E331V unknown Het
Fbn1 T C 2: 125,351,747 N1384S possibly damaging Het
Flt4 A G 11: 49,630,328 E388G possibly damaging Het
Fmn2 T A 1: 174,503,737 probably null Het
Fmo4 T C 1: 162,794,103 Y513C probably benign Het
Gbp4 T C 5: 105,119,553 E500G probably damaging Het
Gm29106 T C 1: 118,199,252 S225P probably damaging Het
Gstt2 G A 10: 75,832,520 R134W probably damaging Het
Gucy1b2 T C 14: 62,392,952 T782A probably benign Het
Gzf1 G T 2: 148,690,082 R543L probably damaging Het
H2-Eb2 G A 17: 34,334,347 G169E probably damaging Het
Hdhd3 T A 4: 62,499,790 R50W probably damaging Het
Hdlbp T C 1: 93,428,222 K407E probably benign Het
Isl2 A G 9: 55,544,956 T271A probably benign Het
Kbtbd7 GTCTCTC GTC 14: 79,427,924 probably null Het
Kdm4b T A 17: 56,396,319 N671K probably damaging Het
Lats1 T A 10: 7,710,891 L939H probably damaging Het
Map3k1 A T 13: 111,756,255 M822K probably damaging Het
Mettl18 C A 1: 163,996,761 T217N probably damaging Het
Nav3 A T 10: 109,696,328 Y2083* probably null Het
Nckap1l T C 15: 103,453,806 probably benign Het
Nkx2-3 A G 19: 43,612,547 D16G probably damaging Het
Nlrx1 A G 9: 44,256,510 S697P probably benign Het
Olfr115 T C 17: 37,610,565 K62R possibly damaging Het
Olfr389 G C 11: 73,776,826 S167C probably benign Het
Olfr731 A T 14: 50,238,368 N172K probably damaging Het
Olfr790 T C 10: 129,501,706 V266A probably damaging Het
Pappa A T 4: 65,189,266 D638V probably damaging Het
Pot1a T C 6: 25,771,622 D200G probably benign Het
Ptprs G T 17: 56,419,502 T1366K probably damaging Het
Sass6 A T 3: 116,620,164 R505S probably benign Het
Slc30a6 T C 17: 74,407,238 I84T probably benign Het
Sox10 A T 15: 79,156,139 F400L probably benign Het
Spata31d1b A T 13: 59,716,909 I624F probably damaging Het
Stpg4 A G 17: 87,427,578 probably null Het
Tbc1d9 G T 8: 83,236,680 K340N probably damaging Het
Tspan12 T A 6: 21,772,683 H289L probably benign Het
Ubr1 T A 2: 120,917,828 T809S probably benign Het
Vmn1r43 C T 6: 89,870,190 V105M probably damaging Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Wnt5a A G 14: 28,518,279 probably null Het
Wwp2 T A 8: 107,517,960 S255T probably benign Het
Zbtb10 A G 3: 9,251,478 T117A possibly damaging Het
Zfp800 C T 6: 28,244,229 V246I probably benign Het
Zfp955a G T 17: 33,244,051 Y35* probably null Het
Other mutations in Efs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Efs APN 14 54921042 missense probably damaging 1.00
IGL02720:Efs APN 14 54919715 missense probably damaging 1.00
IGL02752:Efs APN 14 54917423 missense probably damaging 0.96
R0129:Efs UTSW 14 54917223 missense probably damaging 1.00
R1522:Efs UTSW 14 54919715 missense probably damaging 1.00
R1927:Efs UTSW 14 54917163 missense possibly damaging 0.89
R2327:Efs UTSW 14 54917504 missense probably benign 0.01
R3431:Efs UTSW 14 54920224 missense probably damaging 1.00
R3432:Efs UTSW 14 54920224 missense probably damaging 1.00
R3615:Efs UTSW 14 54920095 missense probably damaging 1.00
R3616:Efs UTSW 14 54920095 missense probably damaging 1.00
R3756:Efs UTSW 14 54920422 splice site probably benign
R3945:Efs UTSW 14 54920651 splice site probably benign
R4448:Efs UTSW 14 54920192 missense probably damaging 1.00
R4717:Efs UTSW 14 54920344 missense probably damaging 0.99
R4819:Efs UTSW 14 54917153 missense probably damaging 0.98
R5656:Efs UTSW 14 54917127 missense probably damaging 1.00
R5946:Efs UTSW 14 54919494 splice site probably null
R6054:Efs UTSW 14 54921157 missense probably damaging 1.00
R7822:Efs UTSW 14 54917450 missense probably benign 0.09
R7970:Efs UTSW 14 54920503 critical splice donor site probably null
R8166:Efs UTSW 14 54920620 missense probably damaging 1.00
R8347:Efs UTSW 14 54919784 missense probably benign 0.28
X0028:Efs UTSW 14 54920621 nonsense probably null
Z1176:Efs UTSW 14 54920336 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGATCATTGGCTACCTCCCTG -3'
(R):5'- TCTGCTCAACCTGTACGAAG -3'

Sequencing Primer
(F):5'- GTTTGAGGCCCCCATAACCAG -3'
(R):5'- TGTACGAAGCACCCGAGG -3'
Posted On2019-10-07