Incidental Mutation 'R7457:H2-Eb2'
ID 578226
Institutional Source Beutler Lab
Gene Symbol H2-Eb2
Ensembl Gene ENSMUSG00000067341
Gene Name histocompatibility 2, class II antigen E beta2
Synonyms A130038H09Rik, Ia5, H-2Eb2, Ia-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R7457 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34325665-34340229 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34334347 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 169 (G169E)
Ref Sequence ENSEMBL: ENSMUSP00000056814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050325]
AlphaFold Q3UUV9
Predicted Effect probably damaging
Transcript: ENSMUST00000050325
AA Change: G169E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056814
Gene: ENSMUSG00000067341
AA Change: G169E

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
MHC_II_beta 42 115 8.29e-35 SMART
IGc1 140 211 1.24e-26 SMART
transmembrane domain 227 249 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,884,619 H452Q probably damaging Het
Adcy8 A T 15: 64,920,680 N142K possibly damaging Het
Alkbh8 T A 9: 3,343,056 S57R probably damaging Het
Atp4a A G 7: 30,720,767 T780A probably benign Het
Atp9b A T 18: 80,917,618 probably null Het
Cdyl2 A T 8: 116,579,196 V442E probably damaging Het
Ces2a C T 8: 104,737,389 R218C possibly damaging Het
Cfap57 A T 4: 118,589,001 V688E probably damaging Het
Clec11a T C 7: 44,305,955 T139A probably benign Het
Clstn1 A T 4: 149,634,916 T411S probably benign Het
Commd5 A T 15: 76,900,624 S74C probably damaging Het
Cyp3a59 C A 5: 146,104,750 P368Q probably damaging Het
Dennd4b A G 3: 90,269,315 M309V probably benign Het
Dhrs9 T A 2: 69,401,267 V257E probably benign Het
Dhx16 T C 17: 35,891,060 V993A probably damaging Het
Dok5 A T 2: 170,870,815 Q247L probably benign Het
E330034G19Rik A T 14: 24,309,514 E331V unknown Het
Efs A G 14: 54,919,994 S287P probably benign Het
Fbn1 T C 2: 125,351,747 N1384S possibly damaging Het
Flt4 A G 11: 49,630,328 E388G possibly damaging Het
Fmn2 T A 1: 174,503,737 probably null Het
Fmo4 T C 1: 162,794,103 Y513C probably benign Het
Gbp4 T C 5: 105,119,553 E500G probably damaging Het
Gm29106 T C 1: 118,199,252 S225P probably damaging Het
Gstt2 G A 10: 75,832,520 R134W probably damaging Het
Gucy1b2 T C 14: 62,392,952 T782A probably benign Het
Gzf1 G T 2: 148,690,082 R543L probably damaging Het
Hdhd3 T A 4: 62,499,790 R50W probably damaging Het
Hdlbp T C 1: 93,428,222 K407E probably benign Het
Isl2 A G 9: 55,544,956 T271A probably benign Het
Kbtbd7 GTCTCTC GTC 14: 79,427,924 probably null Het
Kdm4b T A 17: 56,396,319 N671K probably damaging Het
Lats1 T A 10: 7,710,891 L939H probably damaging Het
Map3k1 A T 13: 111,756,255 M822K probably damaging Het
Mettl18 C A 1: 163,996,761 T217N probably damaging Het
Nav3 A T 10: 109,696,328 Y2083* probably null Het
Nckap1l T C 15: 103,453,806 probably benign Het
Nkx2-3 A G 19: 43,612,547 D16G probably damaging Het
Nlrx1 A G 9: 44,256,510 S697P probably benign Het
Olfr115 T C 17: 37,610,565 K62R possibly damaging Het
Olfr389 G C 11: 73,776,826 S167C probably benign Het
Olfr731 A T 14: 50,238,368 N172K probably damaging Het
Olfr790 T C 10: 129,501,706 V266A probably damaging Het
Pappa A T 4: 65,189,266 D638V probably damaging Het
Pot1a T C 6: 25,771,622 D200G probably benign Het
Ptprs G T 17: 56,419,502 T1366K probably damaging Het
Sass6 A T 3: 116,620,164 R505S probably benign Het
Slc30a6 T C 17: 74,407,238 I84T probably benign Het
Sox10 A T 15: 79,156,139 F400L probably benign Het
Spata31d1b A T 13: 59,716,909 I624F probably damaging Het
Stpg4 A G 17: 87,427,578 probably null Het
Tbc1d9 G T 8: 83,236,680 K340N probably damaging Het
Tspan12 T A 6: 21,772,683 H289L probably benign Het
Ubr1 T A 2: 120,917,828 T809S probably benign Het
Vmn1r43 C T 6: 89,870,190 V105M probably damaging Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Wnt5a A G 14: 28,518,279 probably null Het
Wwp2 T A 8: 107,517,960 S255T probably benign Het
Zbtb10 A G 3: 9,251,478 T117A possibly damaging Het
Zfp800 C T 6: 28,244,229 V246I probably benign Het
Zfp955a G T 17: 33,244,051 Y35* probably null Het
Other mutations in H2-Eb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:H2-Eb2 APN 17 34334367 missense probably damaging 0.98
IGL00965:H2-Eb2 APN 17 34325797 splice site probably null
IGL01380:H2-Eb2 APN 17 34335809 missense probably benign 0.41
IGL02057:H2-Eb2 APN 17 34335767 splice site probably benign
IGL02190:H2-Eb2 APN 17 34334374 missense probably damaging 1.00
IGL02220:H2-Eb2 APN 17 34325687 utr 5 prime probably benign
R0469:H2-Eb2 UTSW 17 34334244 nonsense probably null
R0510:H2-Eb2 UTSW 17 34334244 nonsense probably null
R1169:H2-Eb2 UTSW 17 34333357 missense possibly damaging 0.89
R1334:H2-Eb2 UTSW 17 34334350 missense probably damaging 0.99
R1598:H2-Eb2 UTSW 17 34334374 missense probably damaging 1.00
R1991:H2-Eb2 UTSW 17 34334304 missense probably benign 0.15
R2103:H2-Eb2 UTSW 17 34334304 missense probably benign 0.15
R4191:H2-Eb2 UTSW 17 34344555 unclassified probably benign
R4194:H2-Eb2 UTSW 17 34333326 missense probably benign
R4461:H2-Eb2 UTSW 17 34333523 missense possibly damaging 0.80
R4774:H2-Eb2 UTSW 17 34334401 missense probably damaging 0.99
R4882:H2-Eb2 UTSW 17 34334256 missense probably benign
R5663:H2-Eb2 UTSW 17 34333408 missense possibly damaging 0.92
R6913:H2-Eb2 UTSW 17 34333549 missense possibly damaging 0.89
R7139:H2-Eb2 UTSW 17 34334421 missense probably benign 0.30
R9173:H2-Eb2 UTSW 17 34333517 missense probably benign 0.37
Z1176:H2-Eb2 UTSW 17 34334309 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ACAGGGAGGACAGCTTTATCC -3'
(R):5'- GGCAGAGAAAGTCACTCCTAC -3'

Sequencing Primer
(F):5'- AGGACAGCTTTATCCTCAGGG -3'
(R):5'- ACTCCTACTACACAGTGGTTGGG -3'
Posted On 2019-10-07