Incidental Mutation 'R7457:Ptprs'
ID578230
Institutional Source Beutler Lab
Gene Symbol Ptprs
Ensembl Gene ENSMUSG00000013236
Gene Nameprotein tyrosine phosphatase, receptor type, S
SynonymsPtpt9, PTP-NU3, RPTPsigma, PTPsigma
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7457 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location56412426-56476483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56419502 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1366 (T1366K)
Ref Sequence ENSEMBL: ENSMUSP00000064048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067538] [ENSMUST00000086828] [ENSMUST00000223859]
PDB Structure
Crystal structure of mouse PTPsigma [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000067538
AA Change: T1366K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064048
Gene: ENSMUSG00000013236
AA Change: T1366K

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 605 692 9.69e-9 SMART
FN3 707 796 2.42e-9 SMART
FN3 811 890 2.22e0 SMART
FN3 905 995 8.31e-8 SMART
FN3 1009 1085 3.22e-5 SMART
low complexity region 1164 1177 N/A INTRINSIC
transmembrane domain 1259 1281 N/A INTRINSIC
PTPc 1351 1609 1.54e-136 SMART
PTPc 1638 1900 3.12e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086828
AA Change: T960K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084038
Gene: ENSMUSG00000013236
AA Change: T960K

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 603 679 2.54e-3 SMART
low complexity region 758 771 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
PTPc 945 1203 1.54e-136 SMART
PTPc 1232 1494 3.12e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223859
AA Change: T956K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224777
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Almost half of null homozygotes die in the first day of life. Embryos are characterized by decreased brain size including small pituitary glands and small olfactory bulbs. Adult mice are small, lack estrus, have decreased litter sizes and have impairedolfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,884,619 H452Q probably damaging Het
Adcy8 A T 15: 64,920,680 N142K possibly damaging Het
Alkbh8 T A 9: 3,343,056 S57R probably damaging Het
Atp4a A G 7: 30,720,767 T780A probably benign Het
Cdyl2 A T 8: 116,579,196 V442E probably damaging Het
Ces2a C T 8: 104,737,389 R218C possibly damaging Het
Cfap57 A T 4: 118,589,001 V688E probably damaging Het
Clec11a T C 7: 44,305,955 T139A probably benign Het
Clstn1 A T 4: 149,634,916 T411S probably benign Het
Commd5 A T 15: 76,900,624 S74C probably damaging Het
Cyp3a59 C A 5: 146,104,750 P368Q probably damaging Het
Dennd4b A G 3: 90,269,315 M309V probably benign Het
Dhrs9 T A 2: 69,401,267 V257E probably benign Het
Dhx16 T C 17: 35,891,060 V993A probably damaging Het
Dok5 A T 2: 170,870,815 Q247L probably benign Het
E330034G19Rik A T 14: 24,309,514 E331V unknown Het
Efs A G 14: 54,919,994 S287P probably benign Het
Fbn1 T C 2: 125,351,747 N1384S possibly damaging Het
Flt4 A G 11: 49,630,328 E388G possibly damaging Het
Fmo4 T C 1: 162,794,103 Y513C probably benign Het
Gbp4 T C 5: 105,119,553 E500G probably damaging Het
Gm29106 T C 1: 118,199,252 S225P probably damaging Het
Gstt2 G A 10: 75,832,520 R134W probably damaging Het
Gucy1b2 T C 14: 62,392,952 T782A probably benign Het
Gzf1 G T 2: 148,690,082 R543L probably damaging Het
H2-Eb2 G A 17: 34,334,347 G169E probably damaging Het
Hdhd3 T A 4: 62,499,790 R50W probably damaging Het
Hdlbp T C 1: 93,428,222 K407E probably benign Het
Isl2 A G 9: 55,544,956 T271A probably benign Het
Kbtbd7 GTCTCTC GTC 14: 79,427,924 probably null Het
Kdm4b T A 17: 56,396,319 N671K probably damaging Het
Lats1 T A 10: 7,710,891 L939H probably damaging Het
Map3k1 A T 13: 111,756,255 M822K probably damaging Het
Mettl18 C A 1: 163,996,761 T217N probably damaging Het
Nav3 A T 10: 109,696,328 Y2083* probably null Het
Nkx2-3 A G 19: 43,612,547 D16G probably damaging Het
Nlrx1 A G 9: 44,256,510 S697P probably benign Het
Olfr115 T C 17: 37,610,565 K62R possibly damaging Het
Olfr389 G C 11: 73,776,826 S167C probably benign Het
Olfr731 A T 14: 50,238,368 N172K probably damaging Het
Olfr790 T C 10: 129,501,706 V266A probably damaging Het
Pappa A T 4: 65,189,266 D638V probably damaging Het
Pot1a T C 6: 25,771,622 D200G probably benign Het
Sass6 A T 3: 116,620,164 R505S probably benign Het
Slc30a6 T C 17: 74,407,238 I84T probably benign Het
Sox10 A T 15: 79,156,139 F400L probably benign Het
Spata31d1b A T 13: 59,716,909 I624F probably damaging Het
Stpg4 A G 17: 87,427,578 probably null Het
Tbc1d9 G T 8: 83,236,680 K340N probably damaging Het
Tspan12 T A 6: 21,772,683 H289L probably benign Het
Ubr1 T A 2: 120,917,828 T809S probably benign Het
Vmn1r43 C T 6: 89,870,190 V105M probably damaging Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Wwp2 T A 8: 107,517,960 S255T probably benign Het
Zbtb10 A G 3: 9,251,478 T117A possibly damaging Het
Zfp800 C T 6: 28,244,229 V246I probably benign Het
Zfp955a G T 17: 33,244,051 Y35* probably null Het
Other mutations in Ptprs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Ptprs APN 17 56458243 missense probably damaging 0.99
IGL01388:Ptprs APN 17 56421261 missense probably damaging 1.00
IGL01568:Ptprs APN 17 56413958 missense probably damaging 1.00
IGL01781:Ptprs APN 17 56435676 missense probably damaging 1.00
IGL02499:Ptprs APN 17 56437884 missense probably damaging 1.00
IGL02576:Ptprs APN 17 56414958 missense probably damaging 1.00
IGL02736:Ptprs APN 17 56458248 missense possibly damaging 0.88
IGL02871:Ptprs APN 17 56447443 missense probably damaging 1.00
IGL02946:Ptprs APN 17 56424032 missense probably benign
IGL03061:Ptprs APN 17 56418830 missense probably damaging 0.96
IGL03347:Ptprs APN 17 56435972 missense probably benign 0.07
IGL03351:Ptprs APN 17 56437943 missense probably damaging 1.00
P0019:Ptprs UTSW 17 56447474 splice site probably benign
PIT4434001:Ptprs UTSW 17 56454984 missense probably null 0.02
PIT4520001:Ptprs UTSW 17 56414980 missense probably damaging 1.00
R0240:Ptprs UTSW 17 56436087 unclassified probably null
R0240:Ptprs UTSW 17 56436087 unclassified probably null
R0504:Ptprs UTSW 17 56454220 missense possibly damaging 0.60
R0518:Ptprs UTSW 17 56419621 critical splice donor site probably null
R0539:Ptprs UTSW 17 56458255 missense probably damaging 0.97
R0620:Ptprs UTSW 17 56429103 missense possibly damaging 0.93
R0683:Ptprs UTSW 17 56414086 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1474:Ptprs UTSW 17 56424128 missense probably damaging 0.98
R1502:Ptprs UTSW 17 56437992 missense probably benign 0.00
R1817:Ptprs UTSW 17 56419527 missense probably damaging 1.00
R1844:Ptprs UTSW 17 56434510 missense probably damaging 1.00
R2077:Ptprs UTSW 17 56434990 missense probably null 0.26
R2086:Ptprs UTSW 17 56454984 missense probably null 0.02
R2149:Ptprs UTSW 17 56417706 missense probably damaging 1.00
R3618:Ptprs UTSW 17 56428965 missense probably benign 0.25
R3722:Ptprs UTSW 17 56417485 missense probably damaging 1.00
R3771:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3772:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3773:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R4032:Ptprs UTSW 17 56413386 missense probably damaging 1.00
R4326:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4327:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4480:Ptprs UTSW 17 56426404 missense possibly damaging 0.79
R4505:Ptprs UTSW 17 56451678 missense possibly damaging 0.57
R4507:Ptprs UTSW 17 56419014 missense probably damaging 1.00
R4588:Ptprs UTSW 17 56425534 missense probably damaging 1.00
R4662:Ptprs UTSW 17 56417666 missense probably damaging 1.00
R4708:Ptprs UTSW 17 56428067 missense probably damaging 1.00
R5016:Ptprs UTSW 17 56419070 missense probably damaging 1.00
R5416:Ptprs UTSW 17 56435724 missense probably damaging 1.00
R5447:Ptprs UTSW 17 56429128 missense possibly damaging 0.50
R6041:Ptprs UTSW 17 56419080 missense probably benign 0.00
R6329:Ptprs UTSW 17 56417427 nonsense probably null
R6377:Ptprs UTSW 17 56418935 missense probably damaging 1.00
R6605:Ptprs UTSW 17 56422195 missense probably damaging 1.00
R6749:Ptprs UTSW 17 56437884 missense probably damaging 1.00
R7113:Ptprs UTSW 17 56451697 missense probably benign 0.40
R7114:Ptprs UTSW 17 56451697 missense probably benign 0.40
R7133:Ptprs UTSW 17 56417429 missense probably damaging 1.00
R7220:Ptprs UTSW 17 56418988 missense probably benign 0.29
R7423:Ptprs UTSW 17 56414793 missense probably damaging 1.00
R7440:Ptprs UTSW 17 56424256 missense possibly damaging 0.75
R7574:Ptprs UTSW 17 56423538 missense probably benign 0.00
RF014:Ptprs UTSW 17 56416935 missense probably damaging 1.00
X0028:Ptprs UTSW 17 56437831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACCTCTCCTACAAACCGTG -3'
(R):5'- GCACATGGAGAGACTCAAAGCC -3'

Sequencing Primer
(F):5'- ACCCAGAGCTAACCCTTGGG -3'
(R):5'- TGGAGAGACTCAAAGCCAACGAC -3'
Posted On2019-10-07