Incidental Mutation 'R7458:AI182371'
ID578235
Institutional Source Beutler Lab
Gene Symbol AI182371
Ensembl Gene ENSMUSG00000035875
Gene Nameexpressed sequence AI182371
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_178885; MGI: 2138853

Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location35081861-35101543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35086504 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 206 (R206S)
Ref Sequence ENSEMBL: ENSMUSP00000037754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045776] [ENSMUST00000134940] [ENSMUST00000226375] [ENSMUST00000226631] [ENSMUST00000226972]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045776
AA Change: R206S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037754
Gene: ENSMUSG00000035875
AA Change: R206S

DomainStartEndE-ValueType
Pfam:A2M_N 133 227 4.7e-19 PFAM
ANATO 284 318 1.97e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134940
Predicted Effect probably benign
Transcript: ENSMUST00000226375
Predicted Effect possibly damaging
Transcript: ENSMUST00000226631
AA Change: R217S

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226972
AA Change: R216S

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in AI182371
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02338:AI182371 APN 2 35085716 missense probably benign 0.02
IGL02344:AI182371 APN 2 35089186 missense probably benign 0.01
IGL02817:AI182371 APN 2 35100649 missense probably damaging 0.99
IGL02961:AI182371 APN 2 35086112 missense possibly damaging 0.53
3-1:AI182371 UTSW 2 35100607 missense probably damaging 0.99
R0041:AI182371 UTSW 2 35085721 missense possibly damaging 0.79
R0084:AI182371 UTSW 2 35085702 critical splice donor site probably null
R0472:AI182371 UTSW 2 35085206 missense probably benign 0.35
R1539:AI182371 UTSW 2 35088803 missense probably damaging 0.98
R1634:AI182371 UTSW 2 35086485 missense probably damaging 1.00
R1635:AI182371 UTSW 2 35088737 splice site probably null
R1898:AI182371 UTSW 2 35100649 missense probably damaging 0.99
R2065:AI182371 UTSW 2 35086429 critical splice donor site probably null
R2155:AI182371 UTSW 2 35085354 missense probably benign 0.00
R3694:AI182371 UTSW 2 35085752 missense probably benign 0.00
R3900:AI182371 UTSW 2 35085216 missense probably benign 0.01
R4766:AI182371 UTSW 2 35095817 missense possibly damaging 0.78
R5071:AI182371 UTSW 2 35085215 missense probably benign 0.17
R5500:AI182371 UTSW 2 35100638 missense probably damaging 0.99
R5907:AI182371 UTSW 2 35086122 missense possibly damaging 0.66
R6146:AI182371 UTSW 2 35097971 missense probably damaging 1.00
R6333:AI182371 UTSW 2 35085269 missense probably damaging 0.99
R6729:AI182371 UTSW 2 35084705 intron probably benign
R6732:AI182371 UTSW 2 35084705 intron probably benign
R6742:AI182371 UTSW 2 35084705 intron probably benign
R6781:AI182371 UTSW 2 35084705 intron probably benign
R7196:AI182371 UTSW 2 35086429 critical splice donor site probably null
R7381:AI182371 UTSW 2 35085359 missense probably damaging 1.00
R7466:AI182371 UTSW 2 35088741 nonsense probably null
RF009:AI182371 UTSW 2 35089197 missense possibly damaging 0.90
Z1177:AI182371 UTSW 2 35095759 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACTGAGGAGTGGTTTGTATCAGC -3'
(R):5'- TCAGCTCTCAAACCATGATCG -3'

Sequencing Primer
(F):5'- GAGTGGTTTGTATCAGCTACATTAC -3'
(R):5'- CTCCAAACTTTTACTTAGGGTGTG -3'
Posted On2019-10-07