Incidental Mutation 'R7458:Olfr1031'
ID578236
Institutional Source Beutler Lab
Gene Symbol Olfr1031
Ensembl Gene ENSMUSG00000043267
Gene Nameolfactory receptor 1031
SynonymsGA_x6K02T2Q125-47470765-47471775, MOR200-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85990304-85993704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85992650 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 278 (T278A)
Ref Sequence ENSEMBL: ENSMUSP00000149225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050942] [ENSMUST00000056849] [ENSMUST00000216807]
Predicted Effect probably damaging
Transcript: ENSMUST00000050942
AA Change: T278A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059256
Gene: ENSMUSG00000043267
AA Change: T278A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.1e-55 PFAM
Pfam:7tm_1 40 289 6.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056849
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216807
AA Change: T278A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in Olfr1031
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Olfr1031 APN 2 85992386 missense probably damaging 1.00
IGL02475:Olfr1031 APN 2 85992032 missense probably benign 0.19
IGL03230:Olfr1031 APN 2 85992239 missense probably benign 0.00
IGL03405:Olfr1031 APN 2 85991886 missense possibly damaging 0.84
PIT4151001:Olfr1031 UTSW 2 85992194 missense probably damaging 0.96
PIT4366001:Olfr1031 UTSW 2 85992041 missense probably damaging 1.00
R0344:Olfr1031 UTSW 2 85992382 nonsense probably null
R1168:Olfr1031 UTSW 2 85992684 missense probably damaging 1.00
R1170:Olfr1031 UTSW 2 85992696 missense probably damaging 1.00
R2345:Olfr1031 UTSW 2 85991822 missense probably benign 0.01
R2915:Olfr1031 UTSW 2 85992045 missense probably damaging 1.00
R3498:Olfr1031 UTSW 2 85992430 missense probably benign 0.43
R4058:Olfr1031 UTSW 2 85992232 missense possibly damaging 0.87
R4747:Olfr1031 UTSW 2 85991927 missense probably damaging 1.00
R4859:Olfr1031 UTSW 2 85992731 missense probably damaging 0.96
R4991:Olfr1031 UTSW 2 85992287 missense probably damaging 0.99
R5438:Olfr1031 UTSW 2 85992581 missense probably damaging 1.00
R6362:Olfr1031 UTSW 2 85991941 missense probably damaging 1.00
R7535:Olfr1031 UTSW 2 85991901 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TCCTGCTATTCTGAGGATTAGC -3'
(R):5'- AGACTCATGTAATCCCCTGCC -3'

Sequencing Primer
(F):5'- TTCTGAGGATTAGCTCTACAGAAGGC -3'
(R):5'- GTCACACTTTAAGTTCTTGTCAGTAC -3'
Posted On2019-10-07