Incidental Mutation 'R7458:Necab1'
ID578240
Institutional Source Beutler Lab
Gene Symbol Necab1
Ensembl Gene ENSMUSG00000040536
Gene NameN-terminal EF-hand calcium binding protein 1
Synonyms1700003H21Rik, Efcbp1, NECAB1, STIP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location14952245-15149794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15111244 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 61 (S61R)
Ref Sequence ENSEMBL: ENSMUSP00000038165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041606] [ENSMUST00000108273]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041606
AA Change: S61R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038165
Gene: ENSMUSG00000040536
AA Change: S61R

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
EFh 30 58 4.06e-2 SMART
EFh 64 92 6.56e0 SMART
coiled coil region 135 163 N/A INTRINSIC
coiled coil region 209 244 N/A INTRINSIC
Pfam:ABM 251 326 2.1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108273
AA Change: S61R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103908
Gene: ENSMUSG00000040536
AA Change: S61R

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
EFh 30 58 4.06e-2 SMART
EFh 64 92 6.56e0 SMART
coiled coil region 135 163 N/A INTRINSIC
coiled coil region 209 244 N/A INTRINSIC
Pfam:ABM 251 326 2.4e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in Necab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Necab1 APN 4 15052656 missense probably damaging 1.00
IGL01314:Necab1 APN 4 15005079 missense probably damaging 0.96
IGL01751:Necab1 APN 4 14978171 missense probably damaging 1.00
IGL02098:Necab1 APN 4 14955892 utr 3 prime probably benign
IGL02381:Necab1 APN 4 15148812 splice site probably null
IGL03247:Necab1 APN 4 14960046 missense probably benign
R0095:Necab1 UTSW 4 14960027 missense possibly damaging 0.95
R0095:Necab1 UTSW 4 14960027 missense possibly damaging 0.95
R0321:Necab1 UTSW 4 14960083 missense probably damaging 0.99
R0698:Necab1 UTSW 4 15005041 missense probably benign 0.26
R1125:Necab1 UTSW 4 15111257 missense probably damaging 1.00
R1251:Necab1 UTSW 4 15111192 critical splice donor site probably null
R1400:Necab1 UTSW 4 14975185 missense possibly damaging 0.71
R1505:Necab1 UTSW 4 14960047 missense probably benign 0.26
R1771:Necab1 UTSW 4 15111267 missense probably damaging 1.00
R1776:Necab1 UTSW 4 15111267 missense probably damaging 1.00
R2080:Necab1 UTSW 4 15140219 splice site probably benign
R4705:Necab1 UTSW 4 15052628 missense probably damaging 1.00
R4780:Necab1 UTSW 4 14989248 missense probably benign 0.18
R4795:Necab1 UTSW 4 15111208 missense possibly damaging 0.84
R4972:Necab1 UTSW 4 14978216 missense probably damaging 1.00
R5009:Necab1 UTSW 4 14947503 unclassified probably benign
R6102:Necab1 UTSW 4 14989211 missense probably benign 0.05
R6968:Necab1 UTSW 4 14957852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGTAGTTTCCAGGTAGCAG -3'
(R):5'- ATTGCAAAGGTTTCCTTCTTGC -3'

Sequencing Primer
(F):5'- GTTTCCAGGTAGCAGAAATTTTCAG -3'
(R):5'- CAAGCACAGATGCTAGGA -3'
Posted On2019-10-07