Incidental Mutation 'R7458:Txndc12'
ID578241
Institutional Source Beutler Lab
Gene Symbol Txndc12
Ensembl Gene ENSMUSG00000028567
Gene Namethioredoxin domain containing 12 (endoplasmic reticulum)
SynonymsERp16, 0610040B21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location108834601-108862127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108861409 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 159 (D159G)
Ref Sequence ENSEMBL: ENSMUSP00000030296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030296]
Predicted Effect probably benign
Transcript: ENSMUST00000030296
AA Change: D159G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030296
Gene: ENSMUSG00000028567
AA Change: D159G

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:Thioredoxin_7 37 118 1.1e-19 PFAM
Pfam:Thioredoxin 41 135 1.9e-7 PFAM
Meta Mutation Damage Score 0.0826 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the thioredoxin superfamily. Members of this family are characterized by a conserved active motif called the thioredoxin fold that catalyzes disulfide bond formation and isomerization. This protein localizes to the endoplasmic reticulum and has a single atypical active motif. The encoded protein is mainly involved in catalyzing native disulfide bond formation and displays activity similar to protein-disulfide isomerases. This protein may play a role in defense against endoplasmic reticulum stress. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in Txndc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Txndc12 APN 4 108834792 nonsense probably null
IGL02933:Txndc12 APN 4 108857996 critical splice donor site probably null
R1943:Txndc12 UTSW 4 108856210 missense probably benign 0.01
R7437:Txndc12 UTSW 4 108856171 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACGCCAGGGCTGAAAAC -3'
(R):5'- AATCCCCAAGTGGCTCAAAG -3'

Sequencing Primer
(F):5'- GGCTGAAAACTAGAAGATCTTGATC -3'
(R):5'- ACAGAGCAGCTTCTGTCAGTG -3'
Posted On2019-10-07