Incidental Mutation 'R7458:Akr1a1'
ID578242
Institutional Source Beutler Lab
Gene Symbol Akr1a1
Ensembl Gene ENSMUSG00000028692
Gene Namealdo-keto reductase family 1, member A1 (aldehyde reductase)
SynonymsAkr1a4, 2610201A18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location116636510-116651680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116637817 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 286 (M286K)
Ref Sequence ENSEMBL: ENSMUSP00000030455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030455] [ENSMUST00000128059]
PDB Structure
High resolution structure of mouse aldehyde reductase (AKR1a4) in its apo-form [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030455
AA Change: M286K

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030455
Gene: ENSMUSG00000028692
AA Change: M286K

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 16 294 1.4e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128059
SMART Domains Protein: ENSMUSP00000114861
Gene: ENSMUSG00000028692

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 16 204 3.7e-43 PFAM
Meta Mutation Damage Score 0.8754 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member, also known as aldehyde reductase, is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue. Multiple alternatively spliced transcript variants of this gene exist, all encoding the same protein. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased osteoporosis in response to pregnancy or castration in the absence of dietary ascorbate. Mice homozygous for a knock-out allele exhibit reduced asorbic acid levels and DL-glyceraldehyde, glucuronolactone and glucuronate reductase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in Akr1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02927:Akr1a1 APN 4 116637983 missense probably damaging 1.00
IGL03176:Akr1a1 APN 4 116639075 missense probably damaging 1.00
IGL03265:Akr1a1 APN 4 116637817 missense probably benign 0.42
R0480:Akr1a1 UTSW 4 116639847 missense possibly damaging 0.84
R0972:Akr1a1 UTSW 4 116640007 critical splice acceptor site probably null
R1649:Akr1a1 UTSW 4 116638020 missense probably damaging 1.00
R1711:Akr1a1 UTSW 4 116637974 critical splice donor site probably null
R1727:Akr1a1 UTSW 4 116641051 missense probably damaging 1.00
R1822:Akr1a1 UTSW 4 116636653 missense probably benign 0.13
R4653:Akr1a1 UTSW 4 116637959 unclassified probably benign
R5377:Akr1a1 UTSW 4 116639895 missense probably damaging 1.00
R7386:Akr1a1 UTSW 4 116641054 missense probably damaging 0.98
R8253:Akr1a1 UTSW 4 116636643 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCTCCAACCAGCAAGCCTG -3'
(R):5'- AGTGATCTGCATCCCCAAAAG -3'

Sequencing Primer
(F):5'- AAGCCTGCAGCCAGACCTG -3'
(R):5'- TCCCGCATCCTTCAGAACATTCAG -3'
Posted On2019-10-07