Incidental Mutation 'R7458:Gak'
ID578243
Institutional Source Beutler Lab
Gene Symbol Gak
Ensembl Gene ENSMUSG00000062234
Gene Namecyclin G associated kinase
SynonymsD130045N16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location108569411-108629755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108583074 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 822 (D822G)
Ref Sequence ENSEMBL: ENSMUSP00000036705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046603] [ENSMUST00000135225] [ENSMUST00000139303] [ENSMUST00000145467] [ENSMUST00000199048]
Predicted Effect probably benign
Transcript: ENSMUST00000046603
AA Change: D822G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036705
Gene: ENSMUSG00000062234
AA Change: D822G

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Pkinase 40 313 1.6e-49 PFAM
Pfam:Pkinase_Tyr 40 313 3e-30 PFAM
PTEN_C2 568 707 1.43e-44 SMART
low complexity region 819 833 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
low complexity region 1084 1092 N/A INTRINSIC
low complexity region 1094 1110 N/A INTRINSIC
DnaJ 1240 1301 2.3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135225
SMART Domains Protein: ENSMUSP00000118008
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Pkinase 40 128 7.9e-11 PFAM
Pfam:Pkinase_Tyr 40 128 1.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139303
SMART Domains Protein: ENSMUSP00000116862
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
PTEN_C2 41 164 4.73e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145467
SMART Domains Protein: ENSMUSP00000118713
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Pkinase 40 128 7.9e-11 PFAM
Pfam:Pkinase_Tyr 40 128 1.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156110
AA Change: D124G

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115184
Gene: ENSMUSG00000062234
AA Change: D124G

DomainStartEndE-ValueType
Pfam:PTEN_C2 4 59 9.5e-14 PFAM
low complexity region 122 136 N/A INTRINSIC
low complexity region 235 248 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 397 413 N/A INTRINSIC
DnaJ 543 604 2.3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199048
SMART Domains Protein: ENSMUSP00000142931
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
PDB:4O38|B 23 69 3e-10 PDB
SCOP:d1koba_ 41 69 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200204
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In all eukaryotes, the cell cycle is governed by cyclin-dependent protein kinases (CDKs), whose activities are regulated by cyclins and CDK inhibitors in a diverse array of mechanisms that involve the control of phosphorylation and dephosphorylation of Ser, Thr or Tyr residues. Cyclins are molecules that possess a consensus domain called the 'cyclin box.' In mammalian cells, 9 cyclin species have been identified, and they are referred to as cyclins A through I. Cyclin G is a direct transcriptional target of the p53 tumor suppressor gene product and thus functions downstream of p53. GAK is an association partner of cyclin G and CDK5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a deletion of the kinase domain display neonatal lethality with abnormal lung alveolar morphology and development. Mice homozygous for a knock-out allele exhibit lethality during early development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in Gak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Gak APN 5 108613634 makesense probably null
IGL00768:Gak APN 5 108576654 missense probably benign
IGL01128:Gak APN 5 108592370 missense probably damaging 0.97
IGL01557:Gak APN 5 108584337 missense probably damaging 1.00
IGL02559:Gak APN 5 108584232 missense probably null 0.07
PIT4449001:Gak UTSW 5 108580925 missense probably benign 0.00
R0030:Gak UTSW 5 108613547 nonsense probably null
R1403:Gak UTSW 5 108591145 missense probably damaging 1.00
R1403:Gak UTSW 5 108591145 missense probably damaging 1.00
R1530:Gak UTSW 5 108624193 missense probably damaging 0.97
R1646:Gak UTSW 5 108602854 missense probably damaging 1.00
R1699:Gak UTSW 5 108604377 nonsense probably null
R1702:Gak UTSW 5 108606376 splice site probably null
R1732:Gak UTSW 5 108576582 missense probably benign 0.28
R1738:Gak UTSW 5 108616976 missense probably damaging 1.00
R1772:Gak UTSW 5 108606892 missense probably damaging 1.00
R1792:Gak UTSW 5 108585531 nonsense probably null
R2068:Gak UTSW 5 108570225 missense probably benign
R2137:Gak UTSW 5 108606877 splice site probably null
R2138:Gak UTSW 5 108606877 splice site probably null
R2139:Gak UTSW 5 108606877 splice site probably null
R2904:Gak UTSW 5 108624214 missense possibly damaging 0.70
R3080:Gak UTSW 5 108613602 missense possibly damaging 0.90
R3773:Gak UTSW 5 108582672 missense probably benign 0.00
R4523:Gak UTSW 5 108576566 missense probably benign 0.22
R4665:Gak UTSW 5 108582960 missense probably benign
R4703:Gak UTSW 5 108569877 missense probably damaging 0.99
R4890:Gak UTSW 5 108580876 unclassified probably benign
R4951:Gak UTSW 5 108582718 missense probably benign
R4971:Gak UTSW 5 108596806 missense probably damaging 1.00
R5328:Gak UTSW 5 108617001 missense possibly damaging 0.94
R5436:Gak UTSW 5 108592352 missense possibly damaging 0.94
R5496:Gak UTSW 5 108576617 missense probably benign 0.00
R6207:Gak UTSW 5 108625029 critical splice donor site probably null
R6359:Gak UTSW 5 108571900 missense probably damaging 1.00
R6468:Gak UTSW 5 108623336 nonsense probably null
R6682:Gak UTSW 5 108598876 missense probably damaging 1.00
R6915:Gak UTSW 5 108602950 missense probably benign 0.20
R7403:Gak UTSW 5 108613535 missense probably benign 0.00
R7522:Gak UTSW 5 108591199 missense possibly damaging 0.95
R7650:Gak UTSW 5 108584295 missense probably benign 0.00
R7737:Gak UTSW 5 108617008 missense probably benign 0.15
X0064:Gak UTSW 5 108613533 nonsense probably null
Z1177:Gak UTSW 5 108585352 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AACACCTTCTTCGGGCTGTAC -3'
(R):5'- TGAAGCTTAAGATAGCCCACTG -3'

Sequencing Primer
(F):5'- CAGGCTCCTGTGGGGCAG -3'
(R):5'- CCACTGGGGTTGACATGAG -3'
Posted On2019-10-07