Incidental Mutation 'R7458:2900026A02Rik'
ID578244
Institutional Source Beutler Lab
Gene Symbol 2900026A02Rik
Ensembl Gene ENSMUSG00000051339
Gene NameRIKEN cDNA 2900026A02 gene
SynonymsLOC231620, Gm449
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location113086323-113221236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113190644 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 501 (V501M)
Ref Sequence ENSEMBL: ENSMUSP00000147419 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000211733
AA Change: V501M

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in 2900026A02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02810:2900026A02Rik APN 5 113101535 missense probably damaging 1.00
R1394:2900026A02Rik UTSW 5 113101496 missense probably damaging 1.00
R1395:2900026A02Rik UTSW 5 113101496 missense probably damaging 1.00
R4329:2900026A02Rik UTSW 5 113095589 critical splice donor site probably null
R4766:2900026A02Rik UTSW 5 113097636 missense probably benign 0.01
R6124:2900026A02Rik UTSW 5 113183756 missense probably benign
R6336:2900026A02Rik UTSW 5 113183483 missense possibly damaging 0.88
R6365:2900026A02Rik UTSW 5 113182644 missense probably benign 0.00
R6575:2900026A02Rik UTSW 5 113182817 missense probably damaging 1.00
R6759:2900026A02Rik UTSW 5 113183826 missense probably benign 0.00
R7117:2900026A02Rik UTSW 5 113191384 missense probably benign 0.00
R7168:2900026A02Rik UTSW 5 113137793 missense probably damaging 0.96
R7339:2900026A02Rik UTSW 5 113183072 missense probably benign 0.09
R7450:2900026A02Rik UTSW 5 113184111 missense possibly damaging 0.78
R7525:2900026A02Rik UTSW 5 113183355 missense probably damaging 0.99
R7707:2900026A02Rik UTSW 5 113137986 start codon destroyed probably benign 0.14
R7848:2900026A02Rik UTSW 5 113192141 missense probably damaging 0.96
R7869:2900026A02Rik UTSW 5 113184135 missense possibly damaging 0.47
R7871:2900026A02Rik UTSW 5 113183226 missense probably benign 0.02
R7931:2900026A02Rik UTSW 5 113192141 missense probably damaging 0.96
R7952:2900026A02Rik UTSW 5 113184135 missense possibly damaging 0.47
R7954:2900026A02Rik UTSW 5 113183226 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGAGCTGCTTATCTGCATCATC -3'
(R):5'- CTTACGCACAGACAGAGAGG -3'

Sequencing Primer
(F):5'- CTCCCCTGGAGCAATGGGTG -3'
(R):5'- CTCAGTCTGTTTGGAGAAGACAG -3'
Posted On2019-10-07