Incidental Mutation 'R7458:Cct7'
ID578247
Institutional Source Beutler Lab
Gene Symbol Cct7
Ensembl Gene ENSMUSG00000030007
Gene Namechaperonin containing Tcp1, subunit 7 (eta)
SynonymsCctz, Ccth
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location85451514-85468475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85459996 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 72 (V72A)
Ref Sequence ENSEMBL: ENSMUSP00000032078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032078] [ENSMUST00000204489] [ENSMUST00000204592]
Predicted Effect probably benign
Transcript: ENSMUST00000032078
AA Change: V72A

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032078
Gene: ENSMUSG00000030007
AA Change: V72A

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 32 524 1.8e-163 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204489
SMART Domains Protein: ENSMUSP00000144919
Gene: ENSMUSG00000030007

DomainStartEndE-ValueType
PDB:4B2T|H 1 53 2e-29 PDB
Blast:VWA 5 51 4e-7 BLAST
SCOP:d1a6da1 16 51 2e-8 SMART
low complexity region 68 80 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204592
AA Change: V72A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144893
Gene: ENSMUSG00000030007
AA Change: V72A

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 32 91 6e-21 PFAM
Pfam:Cpn60_TCP1 88 482 5e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204612
Meta Mutation Damage Score 0.1000 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 5 and 6. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in Cct7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02223:Cct7 APN 6 85462041 missense probably benign 0.00
IGL02292:Cct7 APN 6 85461109 missense probably benign 0.03
IGL02724:Cct7 APN 6 85459149 missense probably damaging 1.00
IGL02740:Cct7 APN 6 85468270 missense probably benign
PIT4495001:Cct7 UTSW 6 85459961 missense probably damaging 1.00
R0184:Cct7 UTSW 6 85461554 missense probably null 0.55
R1363:Cct7 UTSW 6 85466035 missense probably damaging 1.00
R1378:Cct7 UTSW 6 85467563 intron probably null
R2076:Cct7 UTSW 6 85468140 missense probably damaging 0.98
R2210:Cct7 UTSW 6 85459230 missense probably damaging 1.00
R3905:Cct7 UTSW 6 85466708 missense possibly damaging 0.90
R4298:Cct7 UTSW 6 85468173 missense probably damaging 1.00
R4422:Cct7 UTSW 6 85467145 missense probably damaging 0.98
R6519:Cct7 UTSW 6 85462150 missense probably benign 0.19
R6903:Cct7 UTSW 6 85466693 missense probably benign 0.27
R6925:Cct7 UTSW 6 85459182 missense probably damaging 1.00
R7133:Cct7 UTSW 6 85466645 missense probably benign 0.02
Z1177:Cct7 UTSW 6 85466669 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGTGGTCAGTTAACCTGTACTC -3'
(R):5'- ACAGTGTCACGCTCACATG -3'

Sequencing Primer
(F):5'- ATTCCCAGCAACTACGTGGTG -3'
(R):5'- CTCTGTAAATACAAGGTCAGCCTGG -3'
Posted On2019-10-07