Incidental Mutation 'R7458:Irs2'
ID578250
Institutional Source Beutler Lab
Gene Symbol Irs2
Ensembl Gene ENSMUSG00000038894
Gene Nameinsulin receptor substrate 2
SynonymsIrs-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.678) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location10984681-11008458 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11007739 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 231 (E231G)
Ref Sequence ENSEMBL: ENSMUSP00000038514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040514]
PDB Structure
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide and ATP [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB phosphopeptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000040514
AA Change: E231G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038514
Gene: ENSMUSG00000038894
AA Change: E231G

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 19 28 N/A INTRINSIC
PH 31 146 2.83e-13 SMART
IRS 191 293 4.98e-38 SMART
PTBI 191 293 2.24e-51 SMART
low complexity region 301 309 N/A INTRINSIC
low complexity region 364 377 N/A INTRINSIC
low complexity region 435 473 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 688 710 N/A INTRINSIC
low complexity region 721 730 N/A INTRINSIC
low complexity region 834 846 N/A INTRINSIC
low complexity region 923 959 N/A INTRINSIC
low complexity region 976 984 N/A INTRINSIC
low complexity region 997 1028 N/A INTRINSIC
low complexity region 1137 1154 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
low complexity region 1274 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in type 2 diabetes due to insulin resistance and pancreatic beta cell dysfunction, causes defects in leptin action, energy balance, lipid homeostasis and vascular wound healing, and leads to female infertility due to hypothalamic and ovarian dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in Irs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Irs2 APN 8 11005867 missense probably benign 0.00
IGL01328:Irs2 APN 8 11004792 missense probably damaging 0.99
IGL01875:Irs2 APN 8 11006221 missense probably damaging 0.98
IGL02444:Irs2 APN 8 11006306 missense probably benign 0.03
IGL02448:Irs2 APN 8 11007862 missense probably benign 0.21
IGL02945:Irs2 APN 8 11007781 missense probably damaging 1.00
IGL03068:Irs2 APN 8 11004974 missense probably damaging 0.99
Dum_dum UTSW 8 10987012 makesense probably null
R0062:Irs2 UTSW 8 11005723 missense possibly damaging 0.65
R0062:Irs2 UTSW 8 11005723 missense possibly damaging 0.65
R0107:Irs2 UTSW 8 11004691 missense probably damaging 1.00
R0147:Irs2 UTSW 8 11007568 missense probably damaging 1.00
R0501:Irs2 UTSW 8 11006396 missense probably damaging 1.00
R0565:Irs2 UTSW 8 11004592 missense probably damaging 0.98
R2042:Irs2 UTSW 8 11007580 missense probably damaging 0.99
R2268:Irs2 UTSW 8 11007586 missense probably damaging 0.98
R2518:Irs2 UTSW 8 11005352 missense probably benign 0.00
R2762:Irs2 UTSW 8 11006408 missense probably damaging 1.00
R3623:Irs2 UTSW 8 11007643 missense probably damaging 1.00
R3624:Irs2 UTSW 8 11007643 missense probably damaging 1.00
R5022:Irs2 UTSW 8 10987012 makesense probably null
R5270:Irs2 UTSW 8 11006678 nonsense probably null
R5377:Irs2 UTSW 8 11005277 missense probably benign 0.00
R5604:Irs2 UTSW 8 11005007 missense possibly damaging 0.84
R6049:Irs2 UTSW 8 11006805 missense probably benign 0.01
R6219:Irs2 UTSW 8 11005121 missense probably damaging 0.99
R6654:Irs2 UTSW 8 11006486 missense probably damaging 1.00
R6726:Irs2 UTSW 8 11004961 missense possibly damaging 0.86
R6813:Irs2 UTSW 8 11004659 nonsense probably null
R6934:Irs2 UTSW 8 11004697 missense probably damaging 0.99
R7261:Irs2 UTSW 8 11007018 missense possibly damaging 0.95
R7285:Irs2 UTSW 8 11006797 missense probably damaging 0.99
R7757:Irs2 UTSW 8 11006522 nonsense probably null
Z1176:Irs2 UTSW 8 11006185 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCTTCTAGGATGGTCTCATGG -3'
(R):5'- TGATCGCCCTCTACACCAAG -3'

Sequencing Primer
(F):5'- ATGGATGTTCTGCGCCAC -3'
(R):5'- ACTTGGTCAGCGAAGGC -3'
Posted On2019-10-07