Incidental Mutation 'R7458:Zfp866'
ID578252
Institutional Source Beutler Lab
Gene Symbol Zfp866
Ensembl Gene ENSMUSG00000043090
Gene Namezinc finger protein 866
Synonyms9830167H18Rik, D330038O06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location69761326-69791178 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 69765552 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 473 (K473*)
Ref Sequence ENSEMBL: ENSMUSP00000119781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000131784] [ENSMUST00000137573] [ENSMUST00000149782]
Predicted Effect probably benign
Transcript: ENSMUST00000126915
SMART Domains Protein: ENSMUSP00000122850
Gene: ENSMUSG00000092544

DomainStartEndE-ValueType
KRAB 16 73 1.96e-17 SMART
PDB:2I13|B 104 210 3e-6 PDB
SCOP:d1fgja_ 114 216 2e-6 SMART
Blast:KRAB 189 209 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131784
SMART Domains Protein: ENSMUSP00000116972
Gene: ENSMUSG00000043090

DomainStartEndE-ValueType
Blast:KRAB 1 35 2e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000137573
AA Change: K473*
SMART Domains Protein: ENSMUSP00000119781
Gene: ENSMUSG00000043090
AA Change: K473*

DomainStartEndE-ValueType
KRAB 4 67 4.26e-18 SMART
ZnF_C2H2 162 184 6.42e-4 SMART
ZnF_C2H2 190 212 3.69e-4 SMART
ZnF_C2H2 218 240 3.89e-3 SMART
ZnF_C2H2 246 268 3.34e-2 SMART
ZnF_C2H2 274 296 1.76e-1 SMART
ZnF_C2H2 302 324 5.42e-2 SMART
ZnF_C2H2 330 352 1.38e-3 SMART
ZnF_C2H2 358 380 6.78e-3 SMART
ZnF_C2H2 386 408 2.09e-3 SMART
ZnF_C2H2 414 436 9.44e-2 SMART
ZnF_C2H2 442 464 2.95e-3 SMART
ZnF_C2H2 470 492 9.73e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149782
SMART Domains Protein: ENSMUSP00000123252
Gene: ENSMUSG00000092544

DomainStartEndE-ValueType
KRAB 80 139 1.2e-17 SMART
ZnF_C2H2 155 177 1.69e-3 SMART
ZnF_C2H2 182 204 8.47e-4 SMART
ZnF_C2H2 210 232 7.15e-2 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Other mutations in Zfp866
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02755:Zfp866 APN 8 69766640 critical splice donor site probably null
R0238:Zfp866 UTSW 8 69766715 missense probably damaging 1.00
R1073:Zfp866 UTSW 8 69767622 splice site probably benign
R1226:Zfp866 UTSW 8 69766290 missense probably damaging 1.00
R1388:Zfp866 UTSW 8 69766184 missense probably benign 0.16
R5129:Zfp866 UTSW 8 69767709 intron probably null
R5204:Zfp866 UTSW 8 69766040 missense probably damaging 0.96
R5225:Zfp866 UTSW 8 69765441 missense possibly damaging 0.93
R5504:Zfp866 UTSW 8 69765691 missense probably benign 0.07
R5912:Zfp866 UTSW 8 69766284 missense probably benign 0.03
R6046:Zfp866 UTSW 8 69765723 missense probably damaging 1.00
R6939:Zfp866 UTSW 8 69766221 missense probably damaging 0.99
R7033:Zfp866 UTSW 8 69765841 missense probably damaging 1.00
R7111:Zfp866 UTSW 8 69766571 missense probably benign 0.05
R7351:Zfp866 UTSW 8 69765897 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCACATGCTTTCACTGGATAAG -3'
(R):5'- ACACTGGAGAGAAACCTTACAAATG -3'

Sequencing Primer
(F):5'- GAATACACTGTAGCACTGTTCAC -3'
(R):5'- TGTAAAGAATGTGGGAAAGCCTTC -3'
Posted On2019-10-07