Incidental Mutation 'R7458:Lgr5'
ID578258
Institutional Source Beutler Lab
Gene Symbol Lgr5
Ensembl Gene ENSMUSG00000020140
Gene Nameleucine rich repeat containing G protein coupled receptor 5
SynonymsGpr49
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010195.2; MGI: 1341817

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location115450311-115587780 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 115457755 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020350] [ENSMUST00000172806] [ENSMUST00000173740]
Predicted Effect probably null
Transcript: ENSMUST00000020350
SMART Domains Protein: ENSMUSP00000020350
Gene: ENSMUSG00000020140

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.73e-4 SMART
LRR_TYP 161 184 5.21e-4 SMART
LRR 185 208 6.22e0 SMART
LRR_TYP 209 232 3.89e-3 SMART
LRR 233 255 9.75e0 SMART
LRR_TYP 256 279 1.38e-3 SMART
Blast:LRR 281 303 2e-6 BLAST
Blast:LRR 304 328 1e-5 BLAST
LRR_TYP 351 374 1.56e-2 SMART
LRR 375 396 1.09e2 SMART
LRR_TYP 397 420 7.26e-3 SMART
LRR 421 444 2.86e-1 SMART
low complexity region 518 533 N/A INTRINSIC
Pfam:7tm_1 574 820 9.5e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172806
SMART Domains Protein: ENSMUSP00000133860
Gene: ENSMUSG00000020140

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.73e-4 SMART
LRR_TYP 161 184 5.21e-4 SMART
LRR 185 208 6.22e0 SMART
LRR_TYP 209 232 3.89e-3 SMART
LRR 233 255 9.75e0 SMART
LRR 256 279 6.57e-1 SMART
Blast:LRR 280 304 1e-5 BLAST
LRR_TYP 327 350 1.56e-2 SMART
LRR 351 372 1.09e2 SMART
LRR_TYP 373 396 7.26e-3 SMART
LRR 397 420 2.86e-1 SMART
low complexity region 494 509 N/A INTRINSIC
Pfam:7tm_1 550 796 8.2e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173740
SMART Domains Protein: ENSMUSP00000133707
Gene: ENSMUSG00000020140

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.08e-4 SMART
LRR 161 183 9.75e0 SMART
LRR_TYP 184 207 1.38e-3 SMART
Blast:LRR 209 231 1e-6 BLAST
Blast:LRR 232 256 1e-5 BLAST
LRR_TYP 279 302 1.56e-2 SMART
LRR 303 324 1.09e2 SMART
LRR_TYP 325 348 7.26e-3 SMART
LRR 349 372 2.86e-1 SMART
low complexity region 446 461 N/A INTRINSIC
Pfam:7tm_1 502 748 7.4e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
MGI Phenotype Strain: 3512420
Lethality: D1-D2
FUNCTION: The protein encoded by this gene is a leucine-rich repeat-containing receptor (LGR) and member of the G protein-coupled, 7-transmembrane receptor (GPCR) superfamily. The encoded protein is a receptor for R-spondins and is involved in the canonical Wnt signaling pathway. This protein plays a role in the formation and maintenance of adult intestinal stem cells during postembryonic development. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display 100% neonatal lethality associated with ankyloglossia, gastrointestinal distension, cyanosis and respiratory failure. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in Lgr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lgr5 APN 10 115454464 missense possibly damaging 0.69
IGL01291:Lgr5 APN 10 115478534 missense probably damaging 1.00
IGL01432:Lgr5 APN 10 115453092 missense probably damaging 1.00
IGL01778:Lgr5 APN 10 115462702 missense probably damaging 0.97
IGL01936:Lgr5 APN 10 115452414 missense probably damaging 1.00
IGL02079:Lgr5 APN 10 115452194 missense probably damaging 1.00
IGL02134:Lgr5 APN 10 115452858 missense possibly damaging 0.89
IGL03083:Lgr5 APN 10 115453032 missense probably benign 0.26
IGL03350:Lgr5 APN 10 115471988 missense probably damaging 0.99
anger UTSW 10 115466346 missense probably benign 0.03
ANU05:Lgr5 UTSW 10 115478534 missense probably damaging 1.00
R0378:Lgr5 UTSW 10 115454499 missense probably damaging 1.00
R0788:Lgr5 UTSW 10 115452997 missense probably damaging 0.99
R1119:Lgr5 UTSW 10 115460811 critical splice donor site probably null
R1321:Lgr5 UTSW 10 115478457 missense probably damaging 1.00
R1880:Lgr5 UTSW 10 115452279 missense probably damaging 1.00
R1985:Lgr5 UTSW 10 115495245 splice site probably benign
R2434:Lgr5 UTSW 10 115587406 missense probably benign
R3055:Lgr5 UTSW 10 115466123 splice site probably benign
R3910:Lgr5 UTSW 10 115587463 missense possibly damaging 0.93
R4686:Lgr5 UTSW 10 115458743 intron probably benign
R4862:Lgr5 UTSW 10 115462764 missense probably damaging 1.00
R4866:Lgr5 UTSW 10 115452685 missense probably benign 0.00
R5089:Lgr5 UTSW 10 115478423 missense probably damaging 1.00
R5118:Lgr5 UTSW 10 115452339 missense possibly damaging 0.88
R5375:Lgr5 UTSW 10 115478564 missense probably benign 0.00
R5537:Lgr5 UTSW 10 115456689 missense probably benign 0.00
R5583:Lgr5 UTSW 10 115478504 missense probably benign 0.32
R6312:Lgr5 UTSW 10 115452924 missense probably damaging 1.00
R6362:Lgr5 UTSW 10 115478525 missense probably damaging 1.00
R6605:Lgr5 UTSW 10 115457867 missense possibly damaging 0.69
R6689:Lgr5 UTSW 10 115466608 missense probably damaging 0.99
R6705:Lgr5 UTSW 10 115587288 missense probably damaging 0.96
R6925:Lgr5 UTSW 10 115466346 missense probably benign 0.03
R7063:Lgr5 UTSW 10 115456734 missense probably damaging 1.00
R7261:Lgr5 UTSW 10 115587465 missense possibly damaging 0.96
R7274:Lgr5 UTSW 10 115452505 missense probably damaging 0.99
R7569:Lgr5 UTSW 10 115462756 missense probably damaging 1.00
R7770:Lgr5 UTSW 10 115471994 missense probably damaging 0.98
Z1176:Lgr5 UTSW 10 115460876 missense probably damaging 0.98
Z1177:Lgr5 UTSW 10 115456669 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTGACTCCAGGAAGCATC -3'
(R):5'- TGCACATTTTATGCTGATGGAG -3'

Sequencing Primer
(F):5'- TGACTCCAGGAAGCATCTTTGAG -3'
(R):5'- CTGATGGAGACTACTAAAAGCCTTG -3'
Posted On2019-10-07