Incidental Mutation 'R7458:Pnn'
ID578263
Institutional Source Beutler Lab
Gene Symbol Pnn
Ensembl Gene ENSMUSG00000020994
Gene Namepinin
SynonymsD12Ertd512e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location59066884-59073998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59072414 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 594 (S594R)
Ref Sequence ENSEMBL: ENSMUSP00000021381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021381] [ENSMUST00000219176]
Predicted Effect unknown
Transcript: ENSMUST00000021381
AA Change: S594R
SMART Domains Protein: ENSMUSP00000021381
Gene: ENSMUSG00000020994
AA Change: S594R

DomainStartEndE-ValueType
Pfam:Pinin_SDK_N 1 132 3.7e-61 PFAM
Pfam:Pinin_SDK_memA 136 261 7.8e-38 PFAM
coiled coil region 290 374 N/A INTRINSIC
low complexity region 451 508 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
internal_repeat_1 559 572 9.16e-7 PROSPERO
internal_repeat_1 563 576 9.16e-7 PROSPERO
low complexity region 579 647 N/A INTRINSIC
low complexity region 651 665 N/A INTRINSIC
low complexity region 671 682 N/A INTRINSIC
low complexity region 695 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219176
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die prior to implantation. Mice homozygous for a hypomorphic allele show complete perinatal lethality, edema, axial skeletal abnormalities, cardiac outflow tract defects, cleft palate, and impaired development of the dorsal dermis and brown fat tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in Pnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02267:Pnn APN 12 59070209 missense probably damaging 1.00
R0350:Pnn UTSW 12 59067117 critical splice donor site probably null
R1853:Pnn UTSW 12 59071613 missense probably damaging 0.99
R1854:Pnn UTSW 12 59071613 missense probably damaging 0.99
R4287:Pnn UTSW 12 59072170 missense possibly damaging 0.86
R4792:Pnn UTSW 12 59072205 missense possibly damaging 0.86
R4812:Pnn UTSW 12 59071618 missense possibly damaging 0.94
R4933:Pnn UTSW 12 59070227 missense probably damaging 1.00
R5541:Pnn UTSW 12 59071930 missense possibly damaging 0.50
R5716:Pnn UTSW 12 59071872 missense probably benign 0.00
R5781:Pnn UTSW 12 59071819 missense probably damaging 0.99
R5963:Pnn UTSW 12 59067831 nonsense probably null
R6877:Pnn UTSW 12 59068767 missense probably damaging 1.00
R6999:Pnn UTSW 12 59070299 critical splice donor site probably null
R7372:Pnn UTSW 12 59068979 missense probably damaging 1.00
R7535:Pnn UTSW 12 59072137 missense probably benign 0.00
Z1177:Pnn UTSW 12 59072799 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCTGAGCGGAAGGATTTTC -3'
(R):5'- GAAGTATCCCTTCGCTTCCG -3'

Sequencing Primer
(F):5'- CCTCTAGAGTCTATAAAACTCCCTG -3'
(R):5'- TGTGCTTCCTATCTCGGTTATG -3'
Posted On2019-10-07