Incidental Mutation 'R7458:Psen1'
ID578264
Institutional Source Beutler Lab
Gene Symbol Psen1
Ensembl Gene ENSMUSG00000019969
Gene Namepresenilin 1
SynonymsPS1, PS-1, S182, presenilin-1, Ad3h
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location83688152-83735199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83714766 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 114 (I114N)
Ref Sequence ENSEMBL: ENSMUSP00000048363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041806] [ENSMUST00000101225]
Predicted Effect probably damaging
Transcript: ENSMUST00000041806
AA Change: I114N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048363
Gene: ENSMUSG00000019969
AA Change: I114N

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Blast:PSN 75 113 1e-12 BLAST
PSN 130 453 2.03e-150 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101225
AA Change: I114N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098786
Gene: ENSMUSG00000019969
AA Change: I114N

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Blast:PSN 75 113 1e-12 BLAST
PSN 130 453 2.03e-150 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alzheimer's disease (AD) patients with an inherited form of the disease carry mutations in the presenilin proteins (PSEN1; PSEN2) or in the amyloid precursor protein (APP). These disease-linked mutations result in increased production of the longer form of amyloid-beta (main component of amyloid deposits found in AD brains). Presenilins are postulated to regulate APP processing through their effects on gamma-secretase, an enzyme that cleaves APP. Also, it is thought that the presenilins are involved in the cleavage of the Notch receptor, such that they either directly regulate gamma-secretase activity or themselves are protease enzymes. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene, the full-length nature of only some have been determined. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deformed axial skeletons, reduced Notch signaling, impaired brain growth with a deficiency of neural stem cells, cerebral hemorrhages, inhibited cleavage of amyloid precursor protein, and perinatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in Psen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Psen1 APN 12 83730569 missense probably benign 0.01
IGL00793:Psen1 APN 12 83723018 missense probably damaging 0.98
IGL03171:Psen1 APN 12 83714864 missense probably damaging 1.00
hiortron UTSW 12 83724665 missense probably damaging 1.00
R0685:Psen1 UTSW 12 83714820 nonsense probably null
R1394:Psen1 UTSW 12 83724572 missense probably damaging 1.00
R1395:Psen1 UTSW 12 83724572 missense probably damaging 1.00
R1681:Psen1 UTSW 12 83724620 missense probably damaging 1.00
R2257:Psen1 UTSW 12 83714820 missense probably damaging 1.00
R4833:Psen1 UTSW 12 83731778 missense probably benign 0.23
R5077:Psen1 UTSW 12 83724665 missense probably damaging 1.00
R5170:Psen1 UTSW 12 83714862 missense probably damaging 1.00
R5782:Psen1 UTSW 12 83712459 missense possibly damaging 0.54
R5804:Psen1 UTSW 12 83731700 missense probably damaging 1.00
R7494:Psen1 UTSW 12 83728243 missense probably benign 0.19
R7797:Psen1 UTSW 12 83699622 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGAAGACGTTATTTTAGAGGATAGCT -3'
(R):5'- CATAGGCAGGTCAAGGCG -3'

Sequencing Primer
(F):5'- ACGTGTTCAAGTACAGCCTG -3'
(R):5'- CAGGTCAAGGCGGACAG -3'
Posted On2019-10-07