Incidental Mutation 'R7458:Slc2a13'
ID578272
Institutional Source Beutler Lab
Gene Symbol Slc2a13
Ensembl Gene ENSMUSG00000036298
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 13
SynonymsA630029G22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location91267696-91573261 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91412187 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 308 (Y308F)
Ref Sequence ENSEMBL: ENSMUSP00000104906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109283]
Predicted Effect probably benign
Transcript: ENSMUST00000109283
AA Change: Y308F

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104906
Gene: ENSMUSG00000036298
AA Change: Y308F

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
Pfam:Sugar_tr 73 412 2e-87 PFAM
Pfam:MFS_1 77 411 6.6e-23 PFAM
Pfam:Sugar_tr 487 598 8.1e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Ubash3a T C 17: 31,208,165 L16P probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in Slc2a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Slc2a13 APN 15 91497399 missense probably benign
IGL01295:Slc2a13 APN 15 91350132 critical splice acceptor site probably null
IGL01863:Slc2a13 APN 15 91516492 missense probably benign 0.00
IGL02149:Slc2a13 APN 15 91343721 missense probably benign
IGL02670:Slc2a13 APN 15 91497509 missense probably damaging 0.99
IGL02692:Slc2a13 APN 15 91321658 missense probably benign 0.23
IGL03307:Slc2a13 APN 15 91276114 missense probably damaging 0.98
R0394:Slc2a13 UTSW 15 91516392 missense probably damaging 1.00
R0624:Slc2a13 UTSW 15 91350012 missense possibly damaging 0.89
R0698:Slc2a13 UTSW 15 91321667 missense probably benign
R0702:Slc2a13 UTSW 15 91321667 missense probably benign
R1052:Slc2a13 UTSW 15 91412160 missense probably damaging 0.96
R2090:Slc2a13 UTSW 15 91516492 missense probably benign 0.00
R2118:Slc2a13 UTSW 15 91516476 missense probably damaging 0.99
R4445:Slc2a13 UTSW 15 91350020 missense possibly damaging 0.46
R4896:Slc2a13 UTSW 15 91412212 missense probably benign 0.20
R6028:Slc2a13 UTSW 15 91276116 missense probably damaging 1.00
R6414:Slc2a13 UTSW 15 91343805 missense probably benign 0.00
R6836:Slc2a13 UTSW 15 91321632 missense probably benign 0.00
R6928:Slc2a13 UTSW 15 91276179 missense probably damaging 1.00
R7353:Slc2a13 UTSW 15 91321604 missense probably benign
R7423:Slc2a13 UTSW 15 91572680 missense probably damaging 1.00
R7641:Slc2a13 UTSW 15 91272156 makesense probably null
R8057:Slc2a13 UTSW 15 91516416 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTAATTGTGACAAAGCATCGAGAG -3'
(R):5'- CCATGAGTTGCTATCAGAATTCTC -3'

Sequencing Primer
(F):5'- GAGAGATCTCTTTCGCCTTCCCG -3'
(R):5'- GGCCTAAAAGTAATGGCTATG -3'
Posted On2019-10-07