Incidental Mutation 'R7458:Ubash3a'
ID578276
Institutional Source Beutler Lab
Gene Symbol Ubash3a
Ensembl Gene ENSMUSG00000042345
Gene Nameubiquitin associated and SH3 domain containing, A
Synonyms5830413C03Rik, Sts-2, TULA
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7458 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location31207873-31242202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31208165 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 16 (L16P)
Ref Sequence ENSEMBL: ENSMUSP00000045890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048656] [ENSMUST00000144772] [ENSMUST00000173776]
PDB Structure
Crystal structure of the 2H-phosphatase domain of Sts-2 [X-RAY DIFFRACTION]
Crystal structure of the 2H-phosphatase domain of Sts-2 in complex with tungstate. [X-RAY DIFFRACTION]
Crystal structure of the 2H-phosphatase domain of Sts-2 in complex with phosphate [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000048656
AA Change: L16P

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000045890
Gene: ENSMUSG00000042345
AA Change: L16P

DomainStartEndE-ValueType
Pfam:UBA 23 57 2.6e-7 PFAM
SH3 241 302 5.53e-10 SMART
Pfam:His_Phos_1 402 601 6.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144772
AA Change: L16P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000119279
Gene: ENSMUSG00000042345
AA Change: L16P

DomainStartEndE-ValueType
Pfam:UBA 21 57 8.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173776
AA Change: L16P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134557
Gene: ENSMUSG00000042345
AA Change: L16P

DomainStartEndE-ValueType
Pfam:UBA 21 57 1.1e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two family members belonging to the T-cell ubiquitin ligand (TULA) family. Both family members can negatively regulate T-cell signaling. This family member can facilitate growth factor withdrawal-induced apoptosis in T cells, which may occur via its interaction with AIF, an apoptosis-inducing factor. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable and healthy with no abnormalities detected in any of the hematopoietic lineages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,190,644 V501M probably benign Het
3632451O06Rik T C 14: 49,682,739 Y711C probably damaging Het
Abca13 T C 11: 9,290,777 F880S possibly damaging Het
AI182371 T A 2: 35,086,504 R206S possibly damaging Het
Akr1a1 A T 4: 116,637,817 M286K possibly damaging Het
Aldh8a1 A G 10: 21,395,593 E406G possibly damaging Het
Ambra1 T A 2: 91,917,684 V1255D probably benign Het
Apol7e C T 15: 77,714,404 T23I probably benign Het
Boc T C 16: 44,486,756 E1034G Het
Bricd5 T C 17: 24,474,502 I39T probably damaging Het
Ccne1 T C 7: 38,100,671 T163A probably damaging Het
Cct7 T C 6: 85,459,996 V72A probably benign Het
Cdh3 A G 8: 106,537,147 D199G probably damaging Het
Clip1 T G 5: 123,640,546 E438A probably damaging Het
Col4a4 T C 1: 82,498,948 I553M unknown Het
Csmd1 A T 8: 15,953,738 N2605K probably damaging Het
Dnajc10 T A 2: 80,324,750 probably null Het
Fbn1 T A 2: 125,319,116 D2168V probably benign Het
G2e3 T A 12: 51,365,507 N443K possibly damaging Het
Gak T C 5: 108,583,074 D822G probably benign Het
Gm9493 A G 19: 23,619,913 I58V probably benign Het
Gpr65 T G 12: 98,276,065 S326A probably damaging Het
Irs2 T C 8: 11,007,739 E231G probably damaging Het
Itga1 T C 13: 114,986,266 D718G probably benign Het
Itih1 T C 14: 30,943,266 M1V probably null Het
Lgr5 A G 10: 115,457,755 probably null Het
Lipn A G 19: 34,071,842 N136S probably benign Het
Lrrc37a G A 11: 103,497,432 T2389I unknown Het
Myo7b G A 18: 31,988,551 A767V possibly damaging Het
Necab1 A T 4: 15,111,244 S61R possibly damaging Het
Olfr1031 A G 2: 85,992,650 T278A probably damaging Het
Phyhip G A 14: 70,461,820 R21H probably damaging Het
Pls1 G A 9: 95,785,507 T116I probably damaging Het
Pnn C A 12: 59,072,414 S594R unknown Het
Psen1 T A 12: 83,714,766 I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Slc12a7 T A 13: 73,785,069 V82E probably damaging Het
Slc25a44 A G 3: 88,416,061 I246T probably benign Het
Slc2a13 T A 15: 91,412,187 Y308F probably benign Het
Sntb2 C A 8: 106,936,298 A166E possibly damaging Het
Tas2r135 T A 6: 42,405,947 V140D possibly damaging Het
Tdrd6 T C 17: 43,625,046 T1704A probably benign Het
Txndc12 A G 4: 108,861,409 D159G probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Vmn2r108 T C 17: 20,472,270 D108G probably benign Het
Vmn2r58 C A 7: 41,837,699 A591S probably benign Het
Wdpcp T C 11: 21,748,919 I566T probably damaging Het
Zfp866 T A 8: 69,765,552 K473* probably null Het
Other mutations in Ubash3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Ubash3a APN 17 31228186 missense probably benign
IGL01310:Ubash3a APN 17 31215142 missense probably benign 0.03
IGL01450:Ubash3a APN 17 31208231 missense probably damaging 1.00
IGL02429:Ubash3a APN 17 31241305 missense probably benign 0.00
IGL02458:Ubash3a APN 17 31231481 missense possibly damaging 0.94
IGL03014:Ubash3a UTSW 17 31239224 missense probably damaging 1.00
R1033:Ubash3a UTSW 17 31208212 missense probably damaging 1.00
R1700:Ubash3a UTSW 17 31215044 missense probably damaging 0.99
R2212:Ubash3a UTSW 17 31218034 missense probably damaging 1.00
R3800:Ubash3a UTSW 17 31231470 missense probably benign 0.24
R4125:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4127:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4128:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4224:Ubash3a UTSW 17 31237928 missense probably damaging 1.00
R4786:Ubash3a UTSW 17 31217964 missense probably benign 0.31
R5311:Ubash3a UTSW 17 31219717 missense probably damaging 0.99
R5782:Ubash3a UTSW 17 31235503 missense probably benign 0.05
R5804:Ubash3a UTSW 17 31208232 critical splice donor site probably null
R6244:Ubash3a UTSW 17 31239272 missense possibly damaging 0.90
R6263:Ubash3a UTSW 17 31215095 missense probably benign 0.22
R6574:Ubash3a UTSW 17 31232396 missense probably damaging 1.00
R6736:Ubash3a UTSW 17 31231415 missense probably benign
R7041:Ubash3a UTSW 17 31228210 missense probably benign 0.00
R7490:Ubash3a UTSW 17 31232312 missense probably damaging 1.00
R7991:Ubash3a UTSW 17 31237895 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GCCCCGAACATTGTGCAAAC -3'
(R):5'- GATCTGCAGGAGAGTAACATTTG -3'

Sequencing Primer
(F):5'- CAGGATATTCACTTGTGTCAGAGAG -3'
(R):5'- GGAGAGTAACATTTGCCCCC -3'
Posted On2019-10-07