Incidental Mutation 'R7458:Lipn'
ID 578280
Institutional Source Beutler Lab
Gene Symbol Lipn
Ensembl Gene ENSMUSG00000024770
Gene Name lipase, family member N
Synonyms 2210418G03Rik, Lipl4
MMRRC Submission 045532-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7458 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 34044758-34062318 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34049242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 136 (N136S)
Ref Sequence ENSEMBL: ENSMUSP00000025682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025682] [ENSMUST00000126710] [ENSMUST00000148821]
AlphaFold Q3U4B4
Predicted Effect probably benign
Transcript: ENSMUST00000025682
AA Change: N136S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025682
Gene: ENSMUSG00000024770
AA Change: N136S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 1.4e-22 PFAM
Pfam:Abhydrolase_5 81 376 1.6e-10 PFAM
Pfam:Abhydrolase_1 81 382 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126710
AA Change: N136S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114551
Gene: ENSMUSG00000024770
AA Change: N136S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 6.4e-23 PFAM
Pfam:Abhydrolase_1 114 181 4.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148821
SMART Domains Protein: ENSMUSP00000120184
Gene: ENSMUSG00000024770

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 83 2.6e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a lipase that is highly expressed in granular keratinocytes in the epidermis, and plays a role in the differentiation of keratinocytes. Mutations in this gene are associated with lamellar ichthyosis type 4. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,338,510 (GRCm39) V501M probably benign Het
Abca13 T C 11: 9,240,777 (GRCm39) F880S possibly damaging Het
AI182371 T A 2: 34,976,516 (GRCm39) R206S possibly damaging Het
Akr1a1 A T 4: 116,495,014 (GRCm39) M286K possibly damaging Het
Aldh8a1 A G 10: 21,271,492 (GRCm39) E406G possibly damaging Het
Ambra1 T A 2: 91,748,029 (GRCm39) V1255D probably benign Het
Apol7e C T 15: 77,598,604 (GRCm39) T23I probably benign Het
Armh4 T C 14: 49,920,196 (GRCm39) Y711C probably damaging Het
Boc T C 16: 44,307,119 (GRCm39) E1034G Het
Bricd5 T C 17: 24,693,476 (GRCm39) I39T probably damaging Het
Ccne1 T C 7: 37,800,096 (GRCm39) T163A probably damaging Het
Cct7 T C 6: 85,436,978 (GRCm39) V72A probably benign Het
Cdh3 A G 8: 107,263,779 (GRCm39) D199G probably damaging Het
Clip1 T G 5: 123,778,609 (GRCm39) E438A probably damaging Het
Col4a4 T C 1: 82,476,669 (GRCm39) I553M unknown Het
Csmd1 A T 8: 16,003,738 (GRCm39) N2605K probably damaging Het
Dnajc10 T A 2: 80,155,094 (GRCm39) probably null Het
Fbn1 T A 2: 125,161,036 (GRCm39) D2168V probably benign Het
G2e3 T A 12: 51,412,290 (GRCm39) N443K possibly damaging Het
Gak T C 5: 108,730,940 (GRCm39) D822G probably benign Het
Gm9493 A G 19: 23,597,277 (GRCm39) I58V probably benign Het
Gpr65 T G 12: 98,242,324 (GRCm39) S326A probably damaging Het
Irs2 T C 8: 11,057,739 (GRCm39) E231G probably damaging Het
Itga1 T C 13: 115,122,802 (GRCm39) D718G probably benign Het
Itih1 T C 14: 30,665,223 (GRCm39) M1V probably null Het
Lgr5 A G 10: 115,293,660 (GRCm39) probably null Het
Lrrc37a G A 11: 103,388,258 (GRCm39) T2389I unknown Het
Myo7b G A 18: 32,121,604 (GRCm39) A767V possibly damaging Het
Necab1 A T 4: 15,111,244 (GRCm39) S61R possibly damaging Het
Or5m8 A G 2: 85,822,994 (GRCm39) T278A probably damaging Het
Phyhip G A 14: 70,699,260 (GRCm39) R21H probably damaging Het
Pls1 G A 9: 95,667,560 (GRCm39) T116I probably damaging Het
Pnn C A 12: 59,119,200 (GRCm39) S594R unknown Het
Psen1 T A 12: 83,761,540 (GRCm39) I114N probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 36,966,991 (GRCm39) probably benign Het
Slc12a7 T A 13: 73,933,188 (GRCm39) V82E probably damaging Het
Slc25a44 A G 3: 88,323,368 (GRCm39) I246T probably benign Het
Slc2a13 T A 15: 91,296,390 (GRCm39) Y308F probably benign Het
Sntb2 C A 8: 107,662,930 (GRCm39) A166E possibly damaging Het
Tas2r135 T A 6: 42,382,881 (GRCm39) V140D possibly damaging Het
Tdrd6 T C 17: 43,935,937 (GRCm39) T1704A probably benign Het
Txndc12 A G 4: 108,718,606 (GRCm39) D159G probably benign Het
Ubash3a T C 17: 31,427,139 (GRCm39) L16P probably benign Het
Usp4 T C 9: 108,245,055 (GRCm39) L331P probably damaging Het
Vmn2r108 T C 17: 20,692,532 (GRCm39) D108G probably benign Het
Vmn2r58 C A 7: 41,487,123 (GRCm39) A591S probably benign Het
Wdpcp T C 11: 21,698,919 (GRCm39) I566T probably damaging Het
Zfp866 T A 8: 70,218,202 (GRCm39) K473* probably null Het
Other mutations in Lipn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lipn APN 19 34,056,435 (GRCm39) missense probably benign 0.06
IGL01320:Lipn APN 19 34,062,040 (GRCm39) missense probably benign 0.07
IGL01827:Lipn APN 19 34,046,880 (GRCm39) missense probably damaging 1.00
IGL02252:Lipn APN 19 34,049,157 (GRCm39) missense probably benign 0.01
IGL02422:Lipn APN 19 34,046,063 (GRCm39) missense probably benign 0.00
R0081:Lipn UTSW 19 34,054,376 (GRCm39) missense probably benign 0.00
R0284:Lipn UTSW 19 34,058,106 (GRCm39) missense possibly damaging 0.87
R0539:Lipn UTSW 19 34,062,003 (GRCm39) unclassified probably benign
R0749:Lipn UTSW 19 34,054,379 (GRCm39) missense probably damaging 1.00
R1170:Lipn UTSW 19 34,049,158 (GRCm39) missense probably benign 0.23
R1528:Lipn UTSW 19 34,046,070 (GRCm39) missense probably damaging 0.96
R1621:Lipn UTSW 19 34,046,113 (GRCm39) missense probably benign
R1675:Lipn UTSW 19 34,058,110 (GRCm39) missense probably damaging 1.00
R1869:Lipn UTSW 19 34,058,139 (GRCm39) missense possibly damaging 0.93
R3236:Lipn UTSW 19 34,046,138 (GRCm39) missense probably benign 0.17
R3237:Lipn UTSW 19 34,046,138 (GRCm39) missense probably benign 0.17
R3832:Lipn UTSW 19 34,046,933 (GRCm39) critical splice donor site probably null
R3876:Lipn UTSW 19 34,046,828 (GRCm39) missense probably benign 0.00
R4084:Lipn UTSW 19 34,056,340 (GRCm39) missense probably benign 0.04
R4595:Lipn UTSW 19 34,058,750 (GRCm39) missense probably damaging 1.00
R5963:Lipn UTSW 19 34,058,700 (GRCm39) missense probably damaging 0.97
R6018:Lipn UTSW 19 34,054,335 (GRCm39) missense probably damaging 1.00
R6797:Lipn UTSW 19 34,058,160 (GRCm39) missense probably benign
R7090:Lipn UTSW 19 34,049,180 (GRCm39) missense possibly damaging 0.72
R7157:Lipn UTSW 19 34,054,390 (GRCm39) nonsense probably null
R8824:Lipn UTSW 19 34,062,116 (GRCm39) missense probably benign 0.04
R8894:Lipn UTSW 19 34,062,248 (GRCm39) makesense probably null
R8933:Lipn UTSW 19 34,046,880 (GRCm39) missense probably damaging 0.98
R9054:Lipn UTSW 19 34,054,376 (GRCm39) missense possibly damaging 0.56
R9117:Lipn UTSW 19 34,046,041 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATAGTGCGTCCTCTGGCAG -3'
(R):5'- TGGACTGTCTAAGAGGAAAGGTTTG -3'

Sequencing Primer
(F):5'- TCCTCTGGCAGGGGTGATATAAATAC -3'
(R):5'- TGTCTAAGAGGAAAGGTTTGAAAGAG -3'
Posted On 2019-10-07