Incidental Mutation 'R7459:Ptpn4'
ID578286
Institutional Source Beutler Lab
Gene Symbol Ptpn4
Ensembl Gene ENSMUSG00000026384
Gene Nameprotein tyrosine phosphatase, non-receptor type 4
SynonymsTEP/mPTPMEG, PTPMEG, TEP, testis-enriched phosphatase, hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R7459 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location119652467-119837613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119659834 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 926 (K926N)
Ref Sequence ENSEMBL: ENSMUSP00000067614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064091] [ENSMUST00000166624]
Predicted Effect probably damaging
Transcript: ENSMUST00000064091
AA Change: K926N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067614
Gene: ENSMUSG00000026384
AA Change: K926N

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDZ 526 605 2.47e-14 SMART
PTPc 654 913 1.38e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166624
SMART Domains Protein: ENSMUSP00000126216
Gene: ENSMUSG00000026384

DomainStartEndE-ValueType
Blast:PTPc 1 65 1e-34 BLAST
PDB:2I75|A 15 67 2e-28 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. This PTP has been shown to interact with glutamate receptor delta 2 and epsilon subunits, and is thought to play a role in signalling downstream of the glutamate receptors through tyrosine dephosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired coordination, abnormal eye blink conditioning behavior, and reduced long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik T G 8: 84,167,352 S383A probably benign Het
Adgre1 T A 17: 57,449,933 V730E probably damaging Het
Agbl1 G A 7: 76,420,066 D449N not run Het
Agr2 A T 12: 35,997,453 E96V probably benign Het
Als2cr12 T G 1: 58,691,752 E48D possibly damaging Het
Atp1a2 A C 1: 172,287,295 S308A probably benign Het
Birc7 T C 2: 180,929,357 S71P possibly damaging Het
Camk2g T C 14: 20,779,207 I73V probably damaging Het
Carf C A 1: 60,128,039 T177K possibly damaging Het
Ccdc191 C T 16: 43,947,457 Q665* probably null Het
Cd79a A T 7: 24,899,142 T39S possibly damaging Het
Ces5a C A 8: 93,535,741 probably benign Het
Dkk2 C A 3: 132,175,029 T145N probably benign Het
Dot1l C T 10: 80,773,173 A188V probably damaging Het
Egfr T A 11: 16,896,967 V788D probably damaging Het
Esyt3 T A 9: 99,358,064 H109L probably benign Het
Fam129c T A 8: 71,605,027 C516S possibly damaging Het
Fam234b C T 6: 135,211,901 T168I probably benign Het
Fan1 G T 7: 64,348,966 S936Y probably damaging Het
Fat2 T C 11: 55,303,919 E1098G probably damaging Het
Fcgbp A G 7: 28,107,285 D2226G possibly damaging Het
Flvcr2 T C 12: 85,747,057 V69A probably benign Het
Foxb2 T A 19: 16,873,072 H190L unknown Het
Fut4 C T 9: 14,751,306 V231M possibly damaging Het
Gtf2a1 G A 12: 91,575,652 A91V probably benign Het
Hip1 A G 5: 135,414,297 S961P probably damaging Het
Hsf2bp C T 17: 31,946,734 V296M probably benign Het
Hspbp1 G T 7: 4,684,578 H11Q probably benign Het
Ighv1-84 C T 12: 115,980,812 E81K probably benign Het
Isg20l2 T C 3: 87,932,178 L232P possibly damaging Het
Isx A G 8: 74,892,764 Y181C probably benign Het
Kif9 A G 9: 110,519,041 Y644C probably damaging Het
Lin7c T A 2: 109,897,337 V177D probably benign Het
Lpin3 T C 2: 160,897,300 S343P probably benign Het
Mat1a A T 14: 41,120,184 Q246L probably benign Het
Mlkl T C 8: 111,333,530 I75V probably benign Het
Ndufa7 T A 17: 33,838,166 S107T probably damaging Het
Nip7 T A 8: 107,057,336 C69* probably null Het
Nipa2 A T 7: 55,933,341 W219R probably damaging Het
Oas2 A C 5: 120,749,710 S22A unknown Het
Obscn A G 11: 59,131,657 V754A probably benign Het
Olfr1249 G A 2: 89,630,668 P77S probably damaging Het
Osbpl1a C T 18: 12,933,585 C39Y probably damaging Het
Pcdhb16 A T 18: 37,479,553 Y522F probably benign Het
Pced1a T G 2: 130,419,824 D303A possibly damaging Het
Peli1 T A 11: 21,148,190 Y308* probably null Het
Pfas T A 11: 68,988,655 R243W Het
Pik3r5 C A 11: 68,492,590 Q412K probably benign Het
Pkd1l1 A T 11: 8,902,428 I1135N Het
Prune1 C A 3: 95,281,710 probably benign Het
Ptpre A G 7: 135,667,600 N277S probably benign Het
Raver2 A T 4: 101,107,213 D255V possibly damaging Het
Rgs20 A G 1: 4,910,634 V187A probably benign Het
Rgs3 A G 4: 62,625,154 E242G probably benign Het
Rims2 T G 15: 39,517,839 S1055R probably benign Het
Rnf146 T C 10: 29,347,644 D82G probably benign Het
Rpgrip1 A G 14: 52,140,559 S455G probably benign Het
Samm50 T C 15: 84,195,856 probably null Het
Sh3bgr A G 16: 96,205,922 K31E probably benign Het
Slc39a8 T C 3: 135,886,911 I449T probably damaging Het
Slc5a3 A T 16: 92,079,017 Y654F probably benign Het
Spata1 T A 3: 146,476,222 L264F possibly damaging Het
Spats2l A T 1: 57,799,353 probably benign Het
Stard13 A C 5: 151,047,599 S848A probably damaging Het
Stat2 A G 10: 128,276,565 S25G possibly damaging Het
Tet2 C T 3: 133,480,289 R1129Q possibly damaging Het
Tmem232 T C 17: 65,256,389 T670A probably benign Het
Tmem266 T C 9: 55,396,599 L3P unknown Het
Tns3 A T 11: 8,492,793 D523E probably benign Het
Trim3 A T 7: 105,617,808 S455T probably damaging Het
Trim31 T C 17: 36,909,662 V490A probably damaging Het
Trmt11 A C 10: 30,590,043 N168K probably benign Het
Trpc4 G A 3: 54,291,232 V526M probably damaging Het
Ttn C A 2: 76,919,138 D3856Y possibly damaging Het
Tulp2 G A 7: 45,519,803 D377N probably damaging Het
Ubl7 A G 9: 57,914,592 T75A probably damaging Het
Ugt2b34 T G 5: 86,901,275 D297A possibly damaging Het
Usp34 A T 11: 23,364,458 H800L possibly damaging Het
Utp3 C A 5: 88,555,553 L314M probably damaging Het
Zer1 A G 2: 30,113,325 Y27H probably damaging Het
Other mutations in Ptpn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ptpn4 APN 1 119659925 splice site probably benign
IGL00885:Ptpn4 APN 1 119802363 missense possibly damaging 0.95
IGL00973:Ptpn4 APN 1 119741371 missense probably benign 0.00
IGL01867:Ptpn4 APN 1 119675599 missense probably benign
IGL01870:Ptpn4 APN 1 119675547 critical splice donor site probably null
IGL02101:Ptpn4 APN 1 119687678 missense probably damaging 1.00
IGL02344:Ptpn4 APN 1 119773260 missense probably damaging 1.00
IGL02348:Ptpn4 APN 1 119682722 missense probably damaging 1.00
IGL02693:Ptpn4 APN 1 119715969 missense probably damaging 0.96
IGL03281:Ptpn4 APN 1 119659912 missense probably damaging 1.00
botched UTSW 1 119743390 missense probably damaging 1.00
bungled UTSW 1 119687605 splice site probably null
hash UTSW 1 119765919 nonsense probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0504:Ptpn4 UTSW 1 119765915 missense probably damaging 1.00
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1148:Ptpn4 UTSW 1 119675709 splice site probably benign
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1662:Ptpn4 UTSW 1 119765058 missense probably damaging 0.96
R1694:Ptpn4 UTSW 1 119783510 missense probably damaging 0.99
R1733:Ptpn4 UTSW 1 119716043 intron probably null
R2083:Ptpn4 UTSW 1 119687759 missense possibly damaging 0.63
R2226:Ptpn4 UTSW 1 119682785 missense probably damaging 1.00
R2276:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R2277:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R3123:Ptpn4 UTSW 1 119765423 splice site probably null
R3425:Ptpn4 UTSW 1 119707830 missense probably benign 0.02
R4568:Ptpn4 UTSW 1 119680059 missense probably damaging 1.00
R4716:Ptpn4 UTSW 1 119721868 missense probably damaging 1.00
R4819:Ptpn4 UTSW 1 119659850 missense probably benign
R4959:Ptpn4 UTSW 1 119765096 nonsense probably null
R5161:Ptpn4 UTSW 1 119707863 nonsense probably null
R5345:Ptpn4 UTSW 1 119765477 missense probably benign
R5471:Ptpn4 UTSW 1 119765919 nonsense probably null
R5826:Ptpn4 UTSW 1 119684516 missense probably benign 0.32
R5933:Ptpn4 UTSW 1 119687723 missense probably damaging 0.97
R6075:Ptpn4 UTSW 1 119765136 missense probably damaging 1.00
R6286:Ptpn4 UTSW 1 119721862 critical splice donor site probably null
R6389:Ptpn4 UTSW 1 119721954 missense probably damaging 0.97
R6392:Ptpn4 UTSW 1 119773123 missense probably benign
R6769:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6771:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6794:Ptpn4 UTSW 1 119743390 missense probably damaging 1.00
R6933:Ptpn4 UTSW 1 119773148 intron probably benign
R6967:Ptpn4 UTSW 1 119684581 nonsense probably null
R6980:Ptpn4 UTSW 1 119743421 missense possibly damaging 0.86
R7150:Ptpn4 UTSW 1 119691745 critical splice donor site probably null
R7247:Ptpn4 UTSW 1 119690034 makesense probably null
R7283:Ptpn4 UTSW 1 119682531 missense possibly damaging 0.90
R7732:Ptpn4 UTSW 1 119692802 missense probably benign
R7794:Ptpn4 UTSW 1 119726037 missense probably damaging 1.00
R8061:Ptpn4 UTSW 1 119691600 critical splice donor site probably null
R8236:Ptpn4 UTSW 1 119678822 missense possibly damaging 0.81
RF014:Ptpn4 UTSW 1 119684465 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCGTCGTTCAGAGCAAAGC -3'
(R):5'- GGTAAAACTTCTAACTCCGTTCTG -3'

Sequencing Primer
(F):5'- TGGTCAACCATGTGAGTAATAGG -3'
(R):5'- AACTCCGTTCTGTTTCATGTTTTAAG -3'
Posted On2019-10-07