Incidental Mutation 'R7459:Lpin3'
ID578293
Institutional Source Beutler Lab
Gene Symbol Lpin3
Ensembl Gene ENSMUSG00000027412
Gene Namelipin 3
Synonyms9130206L11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7459 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location160880670-160906002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 160897300 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 343 (S343P)
Ref Sequence ENSEMBL: ENSMUSP00000105083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109457]
Predicted Effect probably damaging
Transcript: ENSMUST00000040872
AA Change: S343P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412
AA Change: S343P

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109455
AA Change: S343P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412
AA Change: S343P

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109456
AA Change: S343P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412
AA Change: S343P

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109457
AA Change: S343P

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412
AA Change: S343P

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the lipin family of proteins, and all family members share strong homology in their C-terminal region. This protein is thought to form hetero-oligomers with other lipin family members, while one family member, lipin 1, can also form homo-oligomers. This protein contains conserved motifs for phosphatidate phosphatase 1 (PAP1) activity as well as a domain that interacts with a transcriptional co-activator. Lipin complexes act in the cytoplasm to catalyze the dephosphorylation of phosphatidic acid to produce diacylglycerol, which is the precursor of both triglycerides and phospholipids. Lipin complexes are also thought to regulate gene expression as transcriptional co-activators in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik T G 8: 84,167,352 S383A probably benign Het
Adgre1 T A 17: 57,449,933 V730E probably damaging Het
Agbl1 G A 7: 76,420,066 D449N not run Het
Agr2 A T 12: 35,997,453 E96V probably benign Het
Als2cr12 T G 1: 58,691,752 E48D possibly damaging Het
Atp1a2 A C 1: 172,287,295 S308A probably benign Het
Birc7 T C 2: 180,929,357 S71P possibly damaging Het
Camk2g T C 14: 20,779,207 I73V probably damaging Het
Carf C A 1: 60,128,039 T177K possibly damaging Het
Ccdc191 C T 16: 43,947,457 Q665* probably null Het
Cd79a A T 7: 24,899,142 T39S possibly damaging Het
Ces5a C A 8: 93,535,741 probably benign Het
Dkk2 C A 3: 132,175,029 T145N probably benign Het
Dot1l C T 10: 80,773,173 A188V probably damaging Het
Egfr T A 11: 16,896,967 V788D probably damaging Het
Esyt3 T A 9: 99,358,064 H109L probably benign Het
Fam129c T A 8: 71,605,027 C516S possibly damaging Het
Fam234b C T 6: 135,211,901 T168I probably benign Het
Fan1 G T 7: 64,348,966 S936Y probably damaging Het
Fat2 T C 11: 55,303,919 E1098G probably damaging Het
Fcgbp A G 7: 28,107,285 D2226G possibly damaging Het
Flvcr2 T C 12: 85,747,057 V69A probably benign Het
Foxb2 T A 19: 16,873,072 H190L unknown Het
Fut4 C T 9: 14,751,306 V231M possibly damaging Het
Gtf2a1 G A 12: 91,575,652 A91V probably benign Het
Hip1 A G 5: 135,414,297 S961P probably damaging Het
Hsf2bp C T 17: 31,946,734 V296M probably benign Het
Hspbp1 G T 7: 4,684,578 H11Q probably benign Het
Ighv1-84 C T 12: 115,980,812 E81K probably benign Het
Isg20l2 T C 3: 87,932,178 L232P possibly damaging Het
Isx A G 8: 74,892,764 Y181C probably benign Het
Kif9 A G 9: 110,519,041 Y644C probably damaging Het
Lin7c T A 2: 109,897,337 V177D probably benign Het
Mat1a A T 14: 41,120,184 Q246L probably benign Het
Mlkl T C 8: 111,333,530 I75V probably benign Het
Ndufa7 T A 17: 33,838,166 S107T probably damaging Het
Nip7 T A 8: 107,057,336 C69* probably null Het
Nipa2 A T 7: 55,933,341 W219R probably damaging Het
Oas2 A C 5: 120,749,710 S22A unknown Het
Obscn A G 11: 59,131,657 V754A probably benign Het
Olfr1249 G A 2: 89,630,668 P77S probably damaging Het
Osbpl1a C T 18: 12,933,585 C39Y probably damaging Het
Pcdhb16 A T 18: 37,479,553 Y522F probably benign Het
Pced1a T G 2: 130,419,824 D303A possibly damaging Het
Peli1 T A 11: 21,148,190 Y308* probably null Het
Pfas T A 11: 68,988,655 R243W Het
Pik3r5 C A 11: 68,492,590 Q412K probably benign Het
Pkd1l1 A T 11: 8,902,428 I1135N Het
Prune1 C A 3: 95,281,710 probably benign Het
Ptpn4 T A 1: 119,659,834 K926N probably damaging Het
Ptpre A G 7: 135,667,600 N277S probably benign Het
Raver2 A T 4: 101,107,213 D255V possibly damaging Het
Rgs20 A G 1: 4,910,634 V187A probably benign Het
Rgs3 A G 4: 62,625,154 E242G probably benign Het
Rims2 T G 15: 39,517,839 S1055R probably benign Het
Rnf146 T C 10: 29,347,644 D82G probably benign Het
Rpgrip1 A G 14: 52,140,559 S455G probably benign Het
Samm50 T C 15: 84,195,856 probably null Het
Sh3bgr A G 16: 96,205,922 K31E probably benign Het
Slc39a8 T C 3: 135,886,911 I449T probably damaging Het
Slc5a3 A T 16: 92,079,017 Y654F probably benign Het
Spata1 T A 3: 146,476,222 L264F possibly damaging Het
Spats2l A T 1: 57,799,353 probably benign Het
Stard13 A C 5: 151,047,599 S848A probably damaging Het
Stat2 A G 10: 128,276,565 S25G possibly damaging Het
Tet2 C T 3: 133,480,289 R1129Q possibly damaging Het
Tmem232 T C 17: 65,256,389 T670A probably benign Het
Tmem266 T C 9: 55,396,599 L3P unknown Het
Tns3 A T 11: 8,492,793 D523E probably benign Het
Trim3 A T 7: 105,617,808 S455T probably damaging Het
Trim31 T C 17: 36,909,662 V490A probably damaging Het
Trmt11 A C 10: 30,590,043 N168K probably benign Het
Trpc4 G A 3: 54,291,232 V526M probably damaging Het
Ttn C A 2: 76,919,138 D3856Y possibly damaging Het
Tulp2 G A 7: 45,519,803 D377N probably damaging Het
Ubl7 A G 9: 57,914,592 T75A probably damaging Het
Ugt2b34 T G 5: 86,901,275 D297A possibly damaging Het
Usp34 A T 11: 23,364,458 H800L possibly damaging Het
Utp3 C A 5: 88,555,553 L314M probably damaging Het
Zer1 A G 2: 30,113,325 Y27H probably damaging Het
Other mutations in Lpin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Lpin3 APN 2 160893998 missense probably damaging 1.00
IGL01373:Lpin3 APN 2 160903729 missense probably damaging 1.00
IGL01576:Lpin3 APN 2 160897127 missense probably benign 0.02
IGL02124:Lpin3 APN 2 160895833 critical splice donor site probably null
IGL02272:Lpin3 APN 2 160901661 missense probably benign 0.15
IGL02314:Lpin3 APN 2 160898718 nonsense probably null
IGL02374:Lpin3 APN 2 160895838 splice site probably benign
IGL02554:Lpin3 APN 2 160896787 missense probably damaging 1.00
IGL02693:Lpin3 APN 2 160905055 missense probably damaging 1.00
IGL02858:Lpin3 APN 2 160898620 splice site probably benign
IGL03143:Lpin3 APN 2 160903598 splice site probably benign
R0100:Lpin3 UTSW 2 160905340 missense probably damaging 1.00
R0100:Lpin3 UTSW 2 160905340 missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160898681 missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160898681 missense probably damaging 1.00
R0329:Lpin3 UTSW 2 160905305 missense probably benign
R0330:Lpin3 UTSW 2 160905305 missense probably benign
R0570:Lpin3 UTSW 2 160904024 splice site probably benign
R0633:Lpin3 UTSW 2 160903974 missense probably damaging 0.99
R0781:Lpin3 UTSW 2 160894079 missense probably benign 0.03
R1109:Lpin3 UTSW 2 160899021 missense probably damaging 1.00
R1110:Lpin3 UTSW 2 160894079 missense probably benign 0.03
R1404:Lpin3 UTSW 2 160892390 critical splice donor site probably null
R1404:Lpin3 UTSW 2 160892390 critical splice donor site probably null
R1513:Lpin3 UTSW 2 160904548 missense probably damaging 1.00
R1543:Lpin3 UTSW 2 160895390 missense possibly damaging 0.69
R1785:Lpin3 UTSW 2 160896809 nonsense probably null
R1786:Lpin3 UTSW 2 160896809 nonsense probably null
R1896:Lpin3 UTSW 2 160905298 missense probably damaging 1.00
R4440:Lpin3 UTSW 2 160898645 missense probably benign
R4470:Lpin3 UTSW 2 160895434 missense probably benign 0.00
R4996:Lpin3 UTSW 2 160905287 missense probably damaging 1.00
R5014:Lpin3 UTSW 2 160904828 missense probably damaging 1.00
R5124:Lpin3 UTSW 2 160897061 missense probably benign
R5184:Lpin3 UTSW 2 160897138 missense probably benign
R5405:Lpin3 UTSW 2 160903929 missense probably damaging 1.00
R5442:Lpin3 UTSW 2 160905016 missense probably damaging 1.00
R5666:Lpin3 UTSW 2 160897330 missense probably benign
R5670:Lpin3 UTSW 2 160897330 missense probably benign
R5693:Lpin3 UTSW 2 160895400 missense probably benign 0.00
R6084:Lpin3 UTSW 2 160895801 missense probably benign 0.38
R6994:Lpin3 UTSW 2 160904883 missense probably damaging 1.00
R7090:Lpin3 UTSW 2 160896752 missense probably damaging 0.96
R7157:Lpin3 UTSW 2 160898707 missense probably benign 0.02
R7207:Lpin3 UTSW 2 160894003 nonsense probably null
R7430:Lpin3 UTSW 2 160898666 missense probably benign 0.06
R7603:Lpin3 UTSW 2 160903754 splice site probably null
R7644:Lpin3 UTSW 2 160896770 missense probably benign 0.02
R7706:Lpin3 UTSW 2 160905290 missense probably damaging 1.00
R7803:Lpin3 UTSW 2 160895390 missense possibly damaging 0.69
X0002:Lpin3 UTSW 2 160903717 missense probably damaging 1.00
Z1088:Lpin3 UTSW 2 160892231 missense probably damaging 0.99
Z1176:Lpin3 UTSW 2 160899785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGTGCTCTTCCTGAGGAG -3'
(R):5'- CGAGTAAGGTTTGGCATATAGC -3'

Sequencing Primer
(F):5'- TCTTCCTGAGGAGCCTAGC -3'
(R):5'- GCAGCTGCTCAAACTGTACC -3'
Posted On2019-10-07