Incidental Mutation 'R7459:Tet2'
ID578299
Institutional Source Beutler Lab
Gene Symbol Tet2
Ensembl Gene ENSMUSG00000040943
Gene Nametet methylcytosine dioxygenase 2
SynonymsE130014J05Rik, Ayu17-449
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7459 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location133463679-133545139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 133480289 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 1129 (R1129Q)
Ref Sequence ENSEMBL: ENSMUSP00000143029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098603
AA Change: R1129Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: R1129Q

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1203 1819 7e-301 SMART
low complexity region 1832 1844 N/A INTRINSIC
low complexity region 1885 1897 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196398
AA Change: R1129Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: R1129Q

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1211 1827 3.4e-305 SMART
low complexity region 1840 1852 N/A INTRINSIC
low complexity region 1893 1905 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198974
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]
Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik T G 8: 84,167,352 S383A probably benign Het
Adgre1 T A 17: 57,449,933 V730E probably damaging Het
Agbl1 G A 7: 76,420,066 D449N not run Het
Agr2 A T 12: 35,997,453 E96V probably benign Het
Als2cr12 T G 1: 58,691,752 E48D possibly damaging Het
Atp1a2 A C 1: 172,287,295 S308A probably benign Het
Birc7 T C 2: 180,929,357 S71P possibly damaging Het
Camk2g T C 14: 20,779,207 I73V probably damaging Het
Carf C A 1: 60,128,039 T177K possibly damaging Het
Ccdc191 C T 16: 43,947,457 Q665* probably null Het
Cd79a A T 7: 24,899,142 T39S possibly damaging Het
Ces5a C A 8: 93,535,741 probably benign Het
Dkk2 C A 3: 132,175,029 T145N probably benign Het
Dot1l C T 10: 80,773,173 A188V probably damaging Het
Egfr T A 11: 16,896,967 V788D probably damaging Het
Esyt3 T A 9: 99,358,064 H109L probably benign Het
Fam129c T A 8: 71,605,027 C516S possibly damaging Het
Fam234b C T 6: 135,211,901 T168I probably benign Het
Fan1 G T 7: 64,348,966 S936Y probably damaging Het
Fat2 T C 11: 55,303,919 E1098G probably damaging Het
Fcgbp A G 7: 28,107,285 D2226G possibly damaging Het
Flvcr2 T C 12: 85,747,057 V69A probably benign Het
Foxb2 T A 19: 16,873,072 H190L unknown Het
Fut4 C T 9: 14,751,306 V231M possibly damaging Het
Gtf2a1 G A 12: 91,575,652 A91V probably benign Het
Hip1 A G 5: 135,414,297 S961P probably damaging Het
Hsf2bp C T 17: 31,946,734 V296M probably benign Het
Hspbp1 G T 7: 4,684,578 H11Q probably benign Het
Ighv1-84 C T 12: 115,980,812 E81K probably benign Het
Isg20l2 T C 3: 87,932,178 L232P possibly damaging Het
Isx A G 8: 74,892,764 Y181C probably benign Het
Kif9 A G 9: 110,519,041 Y644C probably damaging Het
Lin7c T A 2: 109,897,337 V177D probably benign Het
Lpin3 T C 2: 160,897,300 S343P probably benign Het
Mat1a A T 14: 41,120,184 Q246L probably benign Het
Mlkl T C 8: 111,333,530 I75V probably benign Het
Ndufa7 T A 17: 33,838,166 S107T probably damaging Het
Nip7 T A 8: 107,057,336 C69* probably null Het
Nipa2 A T 7: 55,933,341 W219R probably damaging Het
Oas2 A C 5: 120,749,710 S22A unknown Het
Obscn A G 11: 59,131,657 V754A probably benign Het
Olfr1249 G A 2: 89,630,668 P77S probably damaging Het
Osbpl1a C T 18: 12,933,585 C39Y probably damaging Het
Pcdhb16 A T 18: 37,479,553 Y522F probably benign Het
Pced1a T G 2: 130,419,824 D303A possibly damaging Het
Peli1 T A 11: 21,148,190 Y308* probably null Het
Pfas T A 11: 68,988,655 R243W Het
Pik3r5 C A 11: 68,492,590 Q412K probably benign Het
Pkd1l1 A T 11: 8,902,428 I1135N Het
Prune1 C A 3: 95,281,710 probably benign Het
Ptpn4 T A 1: 119,659,834 K926N probably damaging Het
Ptpre A G 7: 135,667,600 N277S probably benign Het
Raver2 A T 4: 101,107,213 D255V possibly damaging Het
Rgs20 A G 1: 4,910,634 V187A probably benign Het
Rgs3 A G 4: 62,625,154 E242G probably benign Het
Rims2 T G 15: 39,517,839 S1055R probably benign Het
Rnf146 T C 10: 29,347,644 D82G probably benign Het
Rpgrip1 A G 14: 52,140,559 S455G probably benign Het
Samm50 T C 15: 84,195,856 probably null Het
Sh3bgr A G 16: 96,205,922 K31E probably benign Het
Slc39a8 T C 3: 135,886,911 I449T probably damaging Het
Slc5a3 A T 16: 92,079,017 Y654F probably benign Het
Spata1 T A 3: 146,476,222 L264F possibly damaging Het
Spats2l A T 1: 57,799,353 probably benign Het
Stard13 A C 5: 151,047,599 S848A probably damaging Het
Stat2 A G 10: 128,276,565 S25G possibly damaging Het
Tmem232 T C 17: 65,256,389 T670A probably benign Het
Tmem266 T C 9: 55,396,599 L3P unknown Het
Tns3 A T 11: 8,492,793 D523E probably benign Het
Trim3 A T 7: 105,617,808 S455T probably damaging Het
Trim31 T C 17: 36,909,662 V490A probably damaging Het
Trmt11 A C 10: 30,590,043 N168K probably benign Het
Trpc4 G A 3: 54,291,232 V526M probably damaging Het
Ttn C A 2: 76,919,138 D3856Y possibly damaging Het
Tulp2 G A 7: 45,519,803 D377N probably damaging Het
Ubl7 A G 9: 57,914,592 T75A probably damaging Het
Ugt2b34 T G 5: 86,901,275 D297A possibly damaging Het
Usp34 A T 11: 23,364,458 H800L possibly damaging Het
Utp3 C A 5: 88,555,553 L314M probably damaging Het
Zer1 A G 2: 30,113,325 Y27H probably damaging Het
Other mutations in Tet2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Tet2 APN 3 133488085 missense possibly damaging 0.96
IGL00401:Tet2 APN 3 133466882 missense possibly damaging 0.72
IGL01528:Tet2 APN 3 133480298 missense possibly damaging 0.86
IGL02053:Tet2 APN 3 133488523 missense possibly damaging 0.96
IGL02142:Tet2 APN 3 133480139 missense possibly damaging 0.96
IGL02512:Tet2 APN 3 133469308 missense probably benign 0.05
IGL03148:Tet2 APN 3 133481363 missense probably benign 0.18
IGL03182:Tet2 APN 3 133471398 nonsense probably null
IGL03371:Tet2 APN 3 133467551 missense possibly damaging 0.71
P0022:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0023:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0031:Tet2 UTSW 3 133480202 missense possibly damaging 0.53
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0463:Tet2 UTSW 3 133486666 missense possibly damaging 0.86
R0522:Tet2 UTSW 3 133466804 missense probably damaging 0.98
R0593:Tet2 UTSW 3 133488109 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467602 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467725 missense probably benign 0.01
R0698:Tet2 UTSW 3 133467384 missense probably benign 0.32
R0723:Tet2 UTSW 3 133467284 missense probably benign
R0726:Tet2 UTSW 3 133468184 missense probably benign
R0747:Tet2 UTSW 3 133467470 missense possibly damaging 0.86
R1006:Tet2 UTSW 3 133476601 missense possibly damaging 0.53
R1382:Tet2 UTSW 3 133476615 missense probably damaging 1.00
R1455:Tet2 UTSW 3 133473645 missense possibly damaging 0.51
R1550:Tet2 UTSW 3 133469519 missense probably benign 0.32
R1647:Tet2 UTSW 3 133485880 missense probably benign
R1662:Tet2 UTSW 3 133466852 missense possibly damaging 0.96
R1727:Tet2 UTSW 3 133487290 missense probably damaging 0.98
R1738:Tet2 UTSW 3 133481387 missense probably benign 0.08
R1749:Tet2 UTSW 3 133480131 critical splice donor site probably null
R1869:Tet2 UTSW 3 133481441 splice site probably null
R1887:Tet2 UTSW 3 133487333 missense possibly damaging 0.68
R1937:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1939:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1940:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1997:Tet2 UTSW 3 133486589 nonsense probably null
R2082:Tet2 UTSW 3 133485727 missense possibly damaging 0.96
R2084:Tet2 UTSW 3 133487767 missense possibly damaging 0.68
R2215:Tet2 UTSW 3 133486601 missense probably benign 0.03
R2321:Tet2 UTSW 3 133486339 missense possibly damaging 0.53
R2873:Tet2 UTSW 3 133486954 missense probably damaging 1.00
R3439:Tet2 UTSW 3 133466831 missense possibly damaging 0.93
R3783:Tet2 UTSW 3 133479363 missense possibly damaging 0.53
R3894:Tet2 UTSW 3 133469477 missense possibly damaging 0.86
R3916:Tet2 UTSW 3 133486055 missense possibly damaging 0.53
R3966:Tet2 UTSW 3 133487657 missense possibly damaging 0.73
R4457:Tet2 UTSW 3 133485563 missense possibly damaging 0.85
R4633:Tet2 UTSW 3 133485549 missense probably benign 0.33
R4646:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4647:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4648:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4691:Tet2 UTSW 3 133486083 missense possibly damaging 0.73
R4805:Tet2 UTSW 3 133467315 missense probably benign 0.32
R4829:Tet2 UTSW 3 133476620 missense possibly damaging 0.91
R4901:Tet2 UTSW 3 133467044 missense possibly damaging 0.86
R4975:Tet2 UTSW 3 133486759 unclassified probably benign
R5004:Tet2 UTSW 3 133487379 missense possibly damaging 0.84
R5075:Tet2 UTSW 3 133486906 missense probably benign
R5137:Tet2 UTSW 3 133476565 missense probably benign 0.32
R5324:Tet2 UTSW 3 133485913 missense probably benign 0.00
R5590:Tet2 UTSW 3 133476480 splice site probably null
R5854:Tet2 UTSW 3 133487885 missense probably damaging 0.98
R5856:Tet2 UTSW 3 133486640 missense probably benign 0.01
R5865:Tet2 UTSW 3 133487099 missense probably benign 0.08
R5879:Tet2 UTSW 3 133487960 missense possibly damaging 0.96
R5935:Tet2 UTSW 3 133488535 missense possibly damaging 0.68
R6012:Tet2 UTSW 3 133466781 missense possibly damaging 0.86
R6075:Tet2 UTSW 3 133471435 missense possibly damaging 0.71
R6181:Tet2 UTSW 3 133487759 nonsense probably null
R6188:Tet2 UTSW 3 133480326 missense probably benign 0.18
R6339:Tet2 UTSW 3 133486417 missense possibly damaging 0.53
R6612:Tet2 UTSW 3 133487335 missense possibly damaging 0.53
R6923:Tet2 UTSW 3 133479341 critical splice donor site probably null
R6934:Tet2 UTSW 3 133483237 critical splice donor site probably null
R7076:Tet2 UTSW 3 133467023 missense possibly damaging 0.71
R7155:Tet2 UTSW 3 133469591 missense possibly damaging 0.71
R7184:Tet2 UTSW 3 133473630 missense probably damaging 0.98
R7200:Tet2 UTSW 3 133487192 missense probably benign 0.18
R7504:Tet2 UTSW 3 133487339 missense probably benign 0.33
R7524:Tet2 UTSW 3 133480229 missense probably benign 0.33
R7613:Tet2 UTSW 3 133466748 missense possibly damaging 0.83
R7653:Tet2 UTSW 3 133486385 missense probably benign 0.18
R7691:Tet2 UTSW 3 133486849 missense probably damaging 0.98
R7770:Tet2 UTSW 3 133480295 missense possibly damaging 0.53
R7807:Tet2 UTSW 3 133486541 missense possibly damaging 0.53
R7813:Tet2 UTSW 3 133473643 missense probably benign 0.06
R8055:Tet2 UTSW 3 133467992 missense possibly damaging 0.93
X0021:Tet2 UTSW 3 133486295 missense possibly damaging 0.85
X0066:Tet2 UTSW 3 133488373 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATTCAAGCCCCTCTGGAGAAC -3'
(R):5'- ACTCTATAGCTGGGCAATAAAAGAG -3'

Sequencing Primer
(F):5'- CCCCTCTGGAGAACGGGAAAG -3'
(R):5'- GGAATTGCAGTTGGTAATTTTGATCC -3'
Posted On2019-10-07