Incidental Mutation 'R0630:Dgki'
ID 57830
Institutional Source Beutler Lab
Gene Symbol Dgki
Ensembl Gene ENSMUSG00000038665
Gene Name diacylglycerol kinase, iota
Synonyms C130010K08Rik
MMRRC Submission 038819-MU
Accession Numbers

Genbank: NM_001081206.1

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0630 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 36846022-37300184 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 37000198 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 659 (C659F)
Ref Sequence ENSEMBL: ENSMUSP00000099071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042075] [ENSMUST00000090314] [ENSMUST00000101532] [ENSMUST00000138286] [ENSMUST00000150300]
AlphaFold D3YWQ0
Predicted Effect probably damaging
Transcript: ENSMUST00000042075
AA Change: C508F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047858
Gene: ENSMUSG00000038665
AA Change: C508F

DomainStartEndE-ValueType
C1 22 76 3.67e-1 SMART
C1 95 153 5.92e-4 SMART
DAGKc 220 344 6.73e-58 SMART
DAGKa 370 527 2.29e-92 SMART
ANK 792 822 5.53e-3 SMART
ANK 828 857 2.07e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090314
AA Change: C659F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087788
Gene: ENSMUSG00000038665
AA Change: C659F

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 3.67e-1 SMART
C1 246 304 5.92e-4 SMART
DAGKc 371 495 6.73e-58 SMART
DAGKa 521 678 2.29e-92 SMART
ANK 943 973 5.53e-3 SMART
ANK 979 1008 2.07e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101532
AA Change: C659F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099071
Gene: ENSMUSG00000038665
AA Change: C659F

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 3.67e-1 SMART
C1 246 304 5.92e-4 SMART
DAGKc 371 495 6.73e-58 SMART
DAGKa 521 678 2.29e-92 SMART
ANK 964 994 5.53e-3 SMART
ANK 1000 1029 2.07e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000138286
AA Change: C659F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138628
Gene: ENSMUSG00000038665
AA Change: C659F

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 1.8e-3 SMART
C1 246 304 2.9e-6 SMART
DAGKc 371 495 3.2e-60 SMART
DAGKa 521 678 1.1e-94 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143046
Predicted Effect probably benign
Transcript: ENSMUST00000150300
SMART Domains Protein: ENSMUSP00000138457
Gene: ENSMUSG00000038665

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 3.67e-1 SMART
C1 246 304 5.92e-4 SMART
DAGKc 371 495 6.73e-58 SMART
DAGKa 521 591 1.43e-6 SMART
Meta Mutation Damage Score 0.8887 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 97% (108/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type IV diacylglycerol kinase subfamily. Diacylglycerol kinases regulate the intracellular concentration of diacylglycerol through its phosphorylation, producing phosphatidic acid. The specific role of the enzyme encoded by this gene is undetermined, however, it may play a crucial role in the production of phosphatidic acid in the retina or in recessive forms of retinal degeneration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are grossly normal and do not develop tumors when wounded or when exposed to phorbol ester. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Gene trapped(7)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,907 probably benign Het
4930562C15Rik T A 16: 4,850,939 N731K possibly damaging Het
Adgra1 A T 7: 139,852,584 K113* probably null Het
Adgrl2 T C 3: 148,839,244 I659M probably damaging Het
Adm G T 7: 110,628,548 R41L probably damaging Het
Aimp2 T C 5: 143,906,601 E97G probably benign Het
Aox2 T C 1: 58,337,321 probably benign Het
Arhgap20 G A 9: 51,849,384 R809H probably damaging Het
Arsa T C 15: 89,474,004 probably benign Het
Atg2a G T 19: 6,244,517 A88S probably damaging Het
Atm G A 9: 53,531,622 probably benign Het
Atp1a2 A T 1: 172,291,275 I100N possibly damaging Het
BC037034 A G 5: 138,262,289 S292P probably damaging Het
Camta2 G C 11: 70,678,305 L605V probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Ccdc60 A G 5: 116,136,381 V388A possibly damaging Het
Cdk14 C T 5: 5,135,422 probably benign Het
Cdyl2 C T 8: 116,624,035 G119E probably benign Het
Celsr3 A G 9: 108,827,692 N458S probably damaging Het
Chd3 A C 11: 69,347,195 H1808Q probably damaging Het
Cntnap2 T C 6: 46,988,760 V835A probably damaging Het
Col4a1 C A 8: 11,199,889 probably benign Het
Cpsf1 A G 15: 76,601,971 V357A probably damaging Het
Cryzl1 A G 16: 91,707,219 probably benign Het
Cts8 T C 13: 61,253,442 K90R possibly damaging Het
Cux1 A G 5: 136,286,835 V1117A probably damaging Het
Dbx1 T C 7: 49,632,696 T254A probably damaging Het
Dnajc1 T G 2: 18,231,801 D332A probably damaging Het
Dock8 C A 19: 25,061,160 T70K probably benign Het
Dsc1 T A 18: 20,085,862 T828S probably damaging Het
Dst T G 1: 34,193,450 V3510G probably benign Het
Dst T C 1: 34,199,473 V1738A probably damaging Het
Ehmt2 A G 17: 34,899,842 T167A probably benign Het
Eri2 A T 7: 119,786,417 V287E probably benign Het
Fat4 T A 3: 39,000,172 L4121H probably damaging Het
Fbn1 T A 2: 125,394,770 D330V possibly damaging Het
Fign A G 2: 63,980,141 Y262H possibly damaging Het
Fnd3c2 C T X: 106,239,157 M593I probably benign Het
Fndc7 T A 3: 108,876,615 E226V probably damaging Het
Gad2 A T 2: 22,690,336 Q583L probably benign Het
Gcn1l1 G A 5: 115,581,089 A334T probably benign Het
Ggt1 A G 10: 75,585,502 probably null Het
Gli2 C T 1: 118,841,918 G635R possibly damaging Het
Gm10253 T C 3: 88,739,113 E93G unknown Het
Gm10428 A G 11: 62,753,430 probably benign Het
Gm7104 T C 12: 88,285,709 noncoding transcript Het
Gm8258 T G 5: 104,776,519 noncoding transcript Het
Gpr107 A G 2: 31,214,297 N538S possibly damaging Het
Hars T C 18: 36,771,389 E190G probably damaging Het
Hoxc10 C T 15: 102,967,482 P209S probably benign Het
Ighg3 T C 12: 113,360,094 probably benign Het
Igsf10 C A 3: 59,326,062 W1750L probably damaging Het
Igsf5 C A 16: 96,372,823 probably benign Het
Itga10 T C 3: 96,656,299 probably benign Het
Ldhd T C 8: 111,627,302 K422R probably benign Het
Masp1 T C 16: 23,452,419 K693R probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mbd1 T A 18: 74,276,727 probably benign Het
Mdm4 G A 1: 132,991,753 T459I possibly damaging Het
Megf10 A T 18: 57,287,995 I902F probably benign Het
Mta3 A G 17: 83,714,627 N37S probably damaging Het
Mterf3 T A 13: 66,912,308 Y372F probably damaging Het
Nbeal2 A G 9: 110,636,034 probably benign Het
Nbr1 T C 11: 101,567,087 probably benign Het
Ndst3 A G 3: 123,562,071 M103T probably damaging Het
Notch3 C A 17: 32,147,472 probably benign Het
Npr2 A T 4: 43,641,219 E415V probably benign Het
Olfr1105 A T 2: 87,033,309 M304K probably benign Het
Olfr1286 T C 2: 111,420,846 Y35C probably damaging Het
Olfr135 A G 17: 38,208,413 H56R probably damaging Het
Olfr651 G C 7: 104,553,791 V291L probably benign Het
Olfr914 T A 9: 38,606,896 F144I probably benign Het
Pappa2 T A 1: 158,832,773 D1246V probably benign Het
Pcdhgc5 A T 18: 37,821,878 D735V probably benign Het
Pik3ca A G 3: 32,450,027 Y622C possibly damaging Het
Plppr2 A G 9: 21,947,901 D438G probably benign Het
Ppfibp2 A T 7: 107,738,599 probably null Het
Prdm15 A T 16: 97,837,707 L77Q probably null Het
Prdm8 T C 5: 98,184,521 S94P probably damaging Het
Prkdc A T 16: 15,810,801 Q3470L probably damaging Het
Prl3c1 T C 13: 27,200,691 probably benign Het
Ptchd4 A T 17: 42,377,185 H206L probably benign Het
Rack1 G A 11: 48,803,977 probably benign Het
Rere T C 4: 150,619,088 L1509P probably damaging Het
Rgma T A 7: 73,417,618 L301Q probably damaging Het
Rgs6 T A 12: 83,047,550 probably benign Het
Rictor C A 15: 6,794,492 R1613S probably damaging Het
Ripk1 T G 13: 34,027,781 F358C probably damaging Het
Robo2 T C 16: 73,916,205 D1217G probably benign Het
Shc2 A T 10: 79,626,141 W357R probably null Het
Slc25a45 T C 19: 5,880,528 L81P probably damaging Het
Slc9c1 A T 16: 45,543,120 probably benign Het
Spats2 T C 15: 99,186,028 probably null Het
Stac3 A T 10: 127,507,763 E258V probably damaging Het
Thada A G 17: 84,229,175 S1648P probably damaging Het
Tmem168 T C 6: 13,583,065 T222A probably benign Het
Tmtc4 T C 14: 122,926,090 probably benign Het
Trim38 T G 13: 23,791,132 Y351* probably null Het
Trip12 T C 1: 84,793,915 R213G possibly damaging Het
Vav3 C T 3: 109,424,012 R76W probably damaging Het
Vmn1r63 G T 7: 5,803,264 P123H probably damaging Het
Wdr5 A G 2: 27,520,607 N130S probably benign Het
Wnk4 C A 11: 101,265,386 R27S probably damaging Het
Ykt6 G A 11: 5,959,323 S44N probably benign Het
Ythdc1 T A 5: 86,809,348 probably benign Het
Other mutations in Dgki
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Dgki APN 6 36862456 missense probably benign 0.00
IGL00951:Dgki APN 6 37000159 missense probably damaging 0.97
IGL01087:Dgki APN 6 37012911 missense probably damaging 1.00
IGL01396:Dgki APN 6 37000090 missense probably damaging 1.00
IGL02113:Dgki APN 6 36913625 splice site probably benign
IGL02174:Dgki APN 6 37032921 missense probably damaging 1.00
IGL02215:Dgki APN 6 37016675 missense probably damaging 1.00
IGL02353:Dgki APN 6 36847389 missense probably damaging 1.00
IGL02360:Dgki APN 6 36847389 missense probably damaging 1.00
IGL02662:Dgki APN 6 36862486 splice site probably benign
IGL02891:Dgki APN 6 36913741 missense probably benign 0.15
IGL03040:Dgki APN 6 37149664 splice site probably benign
IGL03064:Dgki APN 6 37149664 splice site probably benign
IGL03283:Dgki APN 6 36937311 splice site probably benign
IGL03349:Dgki APN 6 37097627 critical splice acceptor site probably null
H8477:Dgki UTSW 6 37029851 splice site probably benign
PIT4151001:Dgki UTSW 6 37063981 missense probably benign 0.00
R0392:Dgki UTSW 6 37000178 missense probably damaging 1.00
R0718:Dgki UTSW 6 37012896 missense probably damaging 1.00
R1420:Dgki UTSW 6 37050269 splice site probably null
R1546:Dgki UTSW 6 37050203 missense probably damaging 1.00
R1634:Dgki UTSW 6 36915490 missense probably benign
R1639:Dgki UTSW 6 36937364 missense probably damaging 1.00
R1738:Dgki UTSW 6 37057432 missense possibly damaging 0.93
R1750:Dgki UTSW 6 36916434 missense probably damaging 0.96
R1808:Dgki UTSW 6 37149574 missense possibly damaging 0.84
R1834:Dgki UTSW 6 37034701 splice site probably benign
R2001:Dgki UTSW 6 36865801 missense possibly damaging 0.94
R2047:Dgki UTSW 6 36913646 missense possibly damaging 0.69
R2413:Dgki UTSW 6 36847473 missense possibly damaging 0.49
R3034:Dgki UTSW 6 37087670 missense probably damaging 1.00
R4493:Dgki UTSW 6 36974861 intron probably benign
R4684:Dgki UTSW 6 37299846 unclassified probably benign
R4727:Dgki UTSW 6 37299813 unclassified probably benign
R5104:Dgki UTSW 6 37149574 missense possibly damaging 0.84
R5756:Dgki UTSW 6 36937058 intron probably benign
R6946:Dgki UTSW 6 37299636 nonsense probably null
R8357:Dgki UTSW 6 36850956 missense possibly damaging 0.94
R8363:Dgki UTSW 6 37016678 missense probably damaging 1.00
R8424:Dgki UTSW 6 36850915 missense probably benign 0.27
R8457:Dgki UTSW 6 36850956 missense possibly damaging 0.94
R8791:Dgki UTSW 6 37019940 missense probably damaging 1.00
R8880:Dgki UTSW 6 37034717 intron probably benign
R8883:Dgki UTSW 6 37016673 missense probably damaging 1.00
R9000:Dgki UTSW 6 37097708 intron probably benign
R9221:Dgki UTSW 6 37296680 missense probably benign 0.01
R9290:Dgki UTSW 6 37299845 missense unknown
R9320:Dgki UTSW 6 36915487 missense probably damaging 1.00
R9641:Dgki UTSW 6 37149554 missense probably damaging 0.98
R9674:Dgki UTSW 6 37050222 missense probably damaging 0.97
R9726:Dgki UTSW 6 37299923 missense unknown
X0066:Dgki UTSW 6 37063997 missense probably damaging 1.00
Z1177:Dgki UTSW 6 36975225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCAAGGAAGGGCATGTGGTTC -3'
(R):5'- ACGGATGCTATCAAAGGCTGTTGGG -3'

Sequencing Primer
(F):5'- TTTCTAACACAGTGAGGTCCC -3'
(R):5'- ATCTGGATGTGGCTTCCTGAAG -3'
Posted On 2013-07-11