Incidental Mutation 'R7459:Usp34'
ID 578338
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.702) question?
Stock # R7459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 23306895-23490560 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23364458 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 800 (H800L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000137823
AA Change: H800L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: H800L

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180046
AA Change: H781L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: H781L

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik T G 8: 84,167,352 S383A probably benign Het
Adgre1 T A 17: 57,449,933 V730E probably damaging Het
Agbl1 G A 7: 76,420,066 D449N not run Het
Agr2 A T 12: 35,997,453 E96V probably benign Het
Als2cr12 T G 1: 58,691,752 E48D possibly damaging Het
Atp1a2 A C 1: 172,287,295 S308A probably benign Het
Birc7 T C 2: 180,929,357 S71P possibly damaging Het
Camk2g T C 14: 20,779,207 I73V probably damaging Het
Carf C A 1: 60,128,039 T177K possibly damaging Het
Ccdc191 C T 16: 43,947,457 Q665* probably null Het
Cd79a A T 7: 24,899,142 T39S possibly damaging Het
Ces5a C A 8: 93,535,741 probably benign Het
Dkk2 C A 3: 132,175,029 T145N probably benign Het
Dot1l C T 10: 80,773,173 A188V probably damaging Het
Egfr T A 11: 16,896,967 V788D probably damaging Het
Esyt3 T A 9: 99,358,064 H109L probably benign Het
Fam129c T A 8: 71,605,027 C516S possibly damaging Het
Fam234b C T 6: 135,211,901 T168I probably benign Het
Fan1 G T 7: 64,348,966 S936Y probably damaging Het
Fat2 T C 11: 55,303,919 E1098G probably damaging Het
Fcgbp A G 7: 28,107,285 D2226G possibly damaging Het
Flvcr2 T C 12: 85,747,057 V69A probably benign Het
Foxb2 T A 19: 16,873,072 H190L unknown Het
Fut4 C T 9: 14,751,306 V231M possibly damaging Het
Gtf2a1 G A 12: 91,575,652 A91V probably benign Het
Hip1 A G 5: 135,414,297 S961P probably damaging Het
Hsf2bp C T 17: 31,946,734 V296M probably benign Het
Hspbp1 G T 7: 4,684,578 H11Q probably benign Het
Ighv1-84 C T 12: 115,980,812 E81K probably benign Het
Isg20l2 T C 3: 87,932,178 L232P possibly damaging Het
Isx A G 8: 74,892,764 Y181C probably benign Het
Kif9 A G 9: 110,519,041 Y644C probably damaging Het
Lin7c T A 2: 109,897,337 V177D probably benign Het
Lpin3 T C 2: 160,897,300 S343P probably benign Het
Mat1a A T 14: 41,120,184 Q246L probably benign Het
Mlkl T C 8: 111,333,530 I75V probably benign Het
Ndufa7 T A 17: 33,838,166 S107T probably damaging Het
Nip7 T A 8: 107,057,336 C69* probably null Het
Nipa2 A T 7: 55,933,341 W219R probably damaging Het
Oas2 A C 5: 120,749,710 S22A unknown Het
Obscn A G 11: 59,131,657 V754A probably benign Het
Olfr1249 G A 2: 89,630,668 P77S probably damaging Het
Osbpl1a C T 18: 12,933,585 C39Y probably damaging Het
Pcdhb16 A T 18: 37,479,553 Y522F probably benign Het
Pced1a T G 2: 130,419,824 D303A possibly damaging Het
Peli1 T A 11: 21,148,190 Y308* probably null Het
Pfas T A 11: 68,988,655 R243W Het
Pik3r5 C A 11: 68,492,590 Q412K probably benign Het
Pkd1l1 A T 11: 8,902,428 I1135N Het
Prune1 C A 3: 95,281,710 probably benign Het
Ptpn4 T A 1: 119,659,834 K926N probably damaging Het
Ptpre A G 7: 135,667,600 N277S probably benign Het
Raver2 A T 4: 101,107,213 D255V possibly damaging Het
Rgs20 A G 1: 4,910,634 V187A probably benign Het
Rgs3 A G 4: 62,625,154 E242G probably benign Het
Rims2 T G 15: 39,517,839 S1055R probably benign Het
Rnf146 T C 10: 29,347,644 D82G probably benign Het
Rpgrip1 A G 14: 52,140,559 S455G probably benign Het
Samm50 T C 15: 84,195,856 probably null Het
Sh3bgr A G 16: 96,205,922 K31E probably benign Het
Slc39a8 T C 3: 135,886,911 I449T probably damaging Het
Slc5a3 A T 16: 92,079,017 Y654F probably benign Het
Spata1 T A 3: 146,476,222 L264F possibly damaging Het
Spats2l A T 1: 57,799,353 probably benign Het
Stard13 A C 5: 151,047,599 S848A probably damaging Het
Stat2 A G 10: 128,276,565 S25G possibly damaging Het
Tet2 C T 3: 133,480,289 R1129Q possibly damaging Het
Tmem232 T C 17: 65,256,389 T670A probably benign Het
Tmem266 T C 9: 55,396,599 L3P unknown Het
Tns3 A T 11: 8,492,793 D523E probably benign Het
Trim3 A T 7: 105,617,808 S455T probably damaging Het
Trim31 T C 17: 36,909,662 V490A probably damaging Het
Trmt11 A C 10: 30,590,043 N168K probably benign Het
Trpc4 G A 3: 54,291,232 V526M probably damaging Het
Ttn C A 2: 76,919,138 D3856Y possibly damaging Het
Tulp2 G A 7: 45,519,803 D377N probably damaging Het
Ubl7 A G 9: 57,914,592 T75A probably damaging Het
Ugt2b34 T G 5: 86,901,275 D297A possibly damaging Het
Utp3 C A 5: 88,555,553 L314M probably damaging Het
Zer1 A G 2: 30,113,325 Y27H probably damaging Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL00477:Usp34 APN 11 23468879 missense probably damaging 0.99
IGL01307:Usp34 APN 11 23417676 missense probably damaging 0.99
IGL01313:Usp34 APN 11 23473206 missense probably damaging 1.00
IGL01794:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01826:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01827:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01830:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01867:Usp34 APN 11 23384411 missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23345141 splice site probably benign
IGL01977:Usp34 APN 11 23452661 missense probably damaging 1.00
IGL01985:Usp34 APN 11 23452565 missense probably damaging 1.00
IGL02011:Usp34 APN 11 23471554 missense probably damaging 0.99
IGL02302:Usp34 APN 11 23467243 missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23354900 missense probably benign 0.11
IGL02491:Usp34 APN 11 23432630 missense probably damaging 0.98
IGL02532:Usp34 APN 11 23370291 missense probably damaging 0.99
IGL02561:Usp34 APN 11 23351652 missense probably benign 0.09
IGL02706:Usp34 APN 11 23388659 splice site probably benign
IGL02891:Usp34 APN 11 23487166 missense probably benign 0.09
IGL03079:Usp34 APN 11 23432247 missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23446958 missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23488686 missense probably benign
IGL03256:Usp34 APN 11 23420090 nonsense probably null
IGL03280:Usp34 APN 11 23354897 missense probably damaging 1.00
IGL03289:Usp34 APN 11 23393818 missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23446957 missense possibly damaging 0.92
Chub UTSW 11 23464686 missense probably damaging 0.99
Cicione UTSW 11 23489033 missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23457975 missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23343515 missense possibly damaging 0.94
Roebuck UTSW 11 23486810 splice site probably benign
stoat UTSW 11 23487203 missense
tunnelvision UTSW 11 23446968 missense
I2288:Usp34 UTSW 11 23432473 splice site probably benign
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0099:Usp34 UTSW 11 23363111 missense probably damaging 1.00
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0403:Usp34 UTSW 11 23333838 missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23401505 missense probably damaging 0.99
R0446:Usp34 UTSW 11 23467207 missense probably damaging 0.97
R0455:Usp34 UTSW 11 23446741 splice site probably benign
R0470:Usp34 UTSW 11 23436001 missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23384509 splice site probably benign
R0512:Usp34 UTSW 11 23451997 missense probably benign 0.04
R0557:Usp34 UTSW 11 23403848 missense probably damaging 0.98
R0562:Usp34 UTSW 11 23432406 splice site probably benign
R0656:Usp34 UTSW 11 23472967 missense probably damaging 0.99
R0693:Usp34 UTSW 11 23452637 missense probably damaging 0.97
R0739:Usp34 UTSW 11 23467243 missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23384420 missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23433175 splice site probably benign
R1223:Usp34 UTSW 11 23446464 splice site probably null
R1295:Usp34 UTSW 11 23384477 missense probably damaging 1.00
R1430:Usp34 UTSW 11 23459151 missense probably damaging 0.97
R1445:Usp34 UTSW 11 23351629 missense probably damaging 0.99
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1471:Usp34 UTSW 11 23488862 missense probably benign 0.20
R1475:Usp34 UTSW 11 23473253 missense probably damaging 0.99
R1628:Usp34 UTSW 11 23488725 missense probably damaging 1.00
R1631:Usp34 UTSW 11 23460651 missense probably damaging 0.99
R1655:Usp34 UTSW 11 23375051 missense probably benign 0.05
R1741:Usp34 UTSW 11 23364103 missense probably benign 0.00
R1854:Usp34 UTSW 11 23426153 missense probably benign 0.24
R1867:Usp34 UTSW 11 23361593 missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1870:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1871:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1967:Usp34 UTSW 11 23364503 missense probably benign 0.01
R2051:Usp34 UTSW 11 23464468 missense probably damaging 0.97
R2132:Usp34 UTSW 11 23464556 missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23382602 missense probably damaging 0.98
R2205:Usp34 UTSW 11 23385147 missense probably damaging 0.97
R2342:Usp34 UTSW 11 23403599 missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23370466 missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23464517 missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23343640 missense probably benign 0.28
R3972:Usp34 UTSW 11 23457803 missense probably damaging 1.00
R4018:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23417676 missense probably damaging 0.99
R4197:Usp34 UTSW 11 23444189 missense probably damaging 0.98
R4352:Usp34 UTSW 11 23320727 missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23384499 missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23435998 missense probably damaging 0.98
R4475:Usp34 UTSW 11 23457975 missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23401529 missense probably damaging 1.00
R4527:Usp34 UTSW 11 23421257 missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23464633 missense probably damaging 0.97
R4612:Usp34 UTSW 11 23432268 missense probably damaging 0.99
R4673:Usp34 UTSW 11 23364480 small deletion probably benign
R4707:Usp34 UTSW 11 23487215 missense probably damaging 1.00
R4736:Usp34 UTSW 11 23393749 splice site probably null
R4867:Usp34 UTSW 11 23451999 missense probably benign 0.28
R4879:Usp34 UTSW 11 23373410 missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23488982 missense probably damaging 1.00
R5004:Usp34 UTSW 11 23464586 missense probably damaging 1.00
R5057:Usp34 UTSW 11 23458086 intron probably benign
R5068:Usp34 UTSW 11 23460665 missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23343616 missense probably damaging 1.00
R5320:Usp34 UTSW 11 23333739 missense probably benign
R5327:Usp34 UTSW 11 23468846 missense probably damaging 1.00
R5328:Usp34 UTSW 11 23464616 missense probably benign 0.01
R5328:Usp34 UTSW 11 23488659 missense probably benign 0.04
R5390:Usp34 UTSW 11 23444202 critical splice donor site probably null
R5434:Usp34 UTSW 11 23412271 missense probably damaging 0.99
R5523:Usp34 UTSW 11 23349198 missense probably benign 0.39
R5567:Usp34 UTSW 11 23488336 missense probably damaging 0.97
R5571:Usp34 UTSW 11 23457975 missense probably damaging 0.99
R5645:Usp34 UTSW 11 23375024 missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23343515 missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23354846 missense probably benign 0.00
R5813:Usp34 UTSW 11 23421340 missense probably benign 0.38
R5921:Usp34 UTSW 11 23464686 missense probably damaging 0.99
R5928:Usp34 UTSW 11 23436040 missense probably damaging 0.98
R5944:Usp34 UTSW 11 23363089 missense probably damaging 1.00
R6198:Usp34 UTSW 11 23484127 missense probably damaging 1.00
R6229:Usp34 UTSW 11 23446778 missense probably damaging 0.99
R6306:Usp34 UTSW 11 23412260 missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23452520 missense probably damaging 0.98
R6341:Usp34 UTSW 11 23381353 missense probably damaging 0.97
R6374:Usp34 UTSW 11 23438914 missense probably damaging 1.00
R6398:Usp34 UTSW 11 23488666 missense probably benign
R6438:Usp34 UTSW 11 23364266 missense probably benign 0.02
R6668:Usp34 UTSW 11 23460659 missense probably damaging 0.97
R6700:Usp34 UTSW 11 23439011 missense probably damaging 1.00
R6783:Usp34 UTSW 11 23412318 missense probably damaging 1.00
R6821:Usp34 UTSW 11 23367491 missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23452569 missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23458023 missense probably damaging 0.98
R7020:Usp34 UTSW 11 23393954 missense probably benign 0.05
R7026:Usp34 UTSW 11 23361622 missense probably damaging 1.00
R7085:Usp34 UTSW 11 23363097 missense
R7101:Usp34 UTSW 11 23426183 missense
R7168:Usp34 UTSW 11 23464585 missense
R7192:Usp34 UTSW 11 23460571 missense
R7264:Usp34 UTSW 11 23333566 missense probably benign 0.00
R7325:Usp34 UTSW 11 23419052 missense
R7343:Usp34 UTSW 11 23488868 missense
R7358:Usp34 UTSW 11 23361683 missense probably damaging 0.99
R7369:Usp34 UTSW 11 23432361 missense
R7389:Usp34 UTSW 11 23345200 missense
R7517:Usp34 UTSW 11 23446968 missense
R7729:Usp34 UTSW 11 23449268 missense
R7777:Usp34 UTSW 11 23382638 missense
R7810:Usp34 UTSW 11 23412314 missense
R7836:Usp34 UTSW 11 23446614 missense
R7862:Usp34 UTSW 11 23464718 missense
R7993:Usp34 UTSW 11 23377622 missense
R8050:Usp34 UTSW 11 23446787 missense
R8054:Usp34 UTSW 11 23361295 missense
R8239:Usp34 UTSW 11 23446750 missense
R8266:Usp34 UTSW 11 23486810 splice site probably benign
R8347:Usp34 UTSW 11 23412345 missense
R8409:Usp34 UTSW 11 23457811 missense
R8692:Usp34 UTSW 11 23429325 missense
R8694:Usp34 UTSW 11 23484161 missense
R8734:Usp34 UTSW 11 23444184 missense
R8806:Usp34 UTSW 11 23484143 missense
R8914:Usp34 UTSW 11 23343604 missense
R8987:Usp34 UTSW 11 23464267 missense
R9013:Usp34 UTSW 11 23370302 missense
R9108:Usp34 UTSW 11 23370528 missense
R9264:Usp34 UTSW 11 23489064 missense
R9301:Usp34 UTSW 11 23472951 missense
R9375:Usp34 UTSW 11 23487203 missense
R9385:Usp34 UTSW 11 23449223 missense
R9500:Usp34 UTSW 11 23381337 missense probably damaging 0.99
R9566:Usp34 UTSW 11 23367529 missense
R9629:Usp34 UTSW 11 23364364 missense
R9679:Usp34 UTSW 11 23444369 missense
R9680:Usp34 UTSW 11 23367385 missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23474351 missense
R9752:Usp34 UTSW 11 23459182 missense probably benign 0.11
X0023:Usp34 UTSW 11 23375028 missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23457824 missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23473221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTAGATGCCTGTGCTCAC -3'
(R):5'- ACTAGCAACAATCATAGTCTTAGCC -3'

Sequencing Primer
(F):5'- AGATGCCTGTGCTCACTCTGAAG -3'
(R):5'- TCAACTGAAGAAATACTAGCA -3'
Posted On 2019-10-07