Incidental Mutation 'R7459:Pfas'
ID578342
Institutional Source Beutler Lab
Gene Symbol Pfas
Ensembl Gene ENSMUSG00000020899
Gene Namephosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms4432409B16Rik, Sofa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7459 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location68985697-69008460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68988655 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 243 (R243W)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021282]
Predicted Effect probably damaging
Transcript: ENSMUST00000021282
AA Change: R1139W

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: R1139W

DomainStartEndE-ValueType
Pfam:AIRS_C 444 603 1.7e-21 PFAM
low complexity region 615 632 N/A INTRINSIC
low complexity region 786 798 N/A INTRINSIC
Pfam:AIRS_C 853 988 3e-11 PFAM
GATase_5 1061 1332 8.38e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149703
SMART Domains Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

DomainStartEndE-ValueType
Pfam:AIRS_C 3 110 4e-12 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899
AA Change: R243W

DomainStartEndE-ValueType
Pfam:AIRS_C 2 94 1.6e-12 PFAM
GATase_5 166 468 6.88e-120 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik T G 8: 84,167,352 S383A probably benign Het
Adgre1 T A 17: 57,449,933 V730E probably damaging Het
Agbl1 G A 7: 76,420,066 D449N not run Het
Agr2 A T 12: 35,997,453 E96V probably benign Het
Als2cr12 T G 1: 58,691,752 E48D possibly damaging Het
Atp1a2 A C 1: 172,287,295 S308A probably benign Het
Birc7 T C 2: 180,929,357 S71P possibly damaging Het
Camk2g T C 14: 20,779,207 I73V probably damaging Het
Carf C A 1: 60,128,039 T177K possibly damaging Het
Ccdc191 C T 16: 43,947,457 Q665* probably null Het
Cd79a A T 7: 24,899,142 T39S possibly damaging Het
Ces5a C A 8: 93,535,741 probably benign Het
Dkk2 C A 3: 132,175,029 T145N probably benign Het
Dot1l C T 10: 80,773,173 A188V probably damaging Het
Egfr T A 11: 16,896,967 V788D probably damaging Het
Esyt3 T A 9: 99,358,064 H109L probably benign Het
Fam129c T A 8: 71,605,027 C516S possibly damaging Het
Fam234b C T 6: 135,211,901 T168I probably benign Het
Fan1 G T 7: 64,348,966 S936Y probably damaging Het
Fat2 T C 11: 55,303,919 E1098G probably damaging Het
Fcgbp A G 7: 28,107,285 D2226G possibly damaging Het
Flvcr2 T C 12: 85,747,057 V69A probably benign Het
Foxb2 T A 19: 16,873,072 H190L unknown Het
Fut4 C T 9: 14,751,306 V231M possibly damaging Het
Gtf2a1 G A 12: 91,575,652 A91V probably benign Het
Hip1 A G 5: 135,414,297 S961P probably damaging Het
Hsf2bp C T 17: 31,946,734 V296M probably benign Het
Hspbp1 G T 7: 4,684,578 H11Q probably benign Het
Ighv1-84 C T 12: 115,980,812 E81K probably benign Het
Isg20l2 T C 3: 87,932,178 L232P possibly damaging Het
Isx A G 8: 74,892,764 Y181C probably benign Het
Kif9 A G 9: 110,519,041 Y644C probably damaging Het
Lin7c T A 2: 109,897,337 V177D probably benign Het
Lpin3 T C 2: 160,897,300 S343P probably benign Het
Mat1a A T 14: 41,120,184 Q246L probably benign Het
Mlkl T C 8: 111,333,530 I75V probably benign Het
Ndufa7 T A 17: 33,838,166 S107T probably damaging Het
Nip7 T A 8: 107,057,336 C69* probably null Het
Nipa2 A T 7: 55,933,341 W219R probably damaging Het
Oas2 A C 5: 120,749,710 S22A unknown Het
Obscn A G 11: 59,131,657 V754A probably benign Het
Olfr1249 G A 2: 89,630,668 P77S probably damaging Het
Osbpl1a C T 18: 12,933,585 C39Y probably damaging Het
Pcdhb16 A T 18: 37,479,553 Y522F probably benign Het
Pced1a T G 2: 130,419,824 D303A possibly damaging Het
Peli1 T A 11: 21,148,190 Y308* probably null Het
Pik3r5 C A 11: 68,492,590 Q412K probably benign Het
Pkd1l1 A T 11: 8,902,428 I1135N Het
Prune1 C A 3: 95,281,710 probably benign Het
Ptpn4 T A 1: 119,659,834 K926N probably damaging Het
Ptpre A G 7: 135,667,600 N277S probably benign Het
Raver2 A T 4: 101,107,213 D255V possibly damaging Het
Rgs20 A G 1: 4,910,634 V187A probably benign Het
Rgs3 A G 4: 62,625,154 E242G probably benign Het
Rims2 T G 15: 39,517,839 S1055R probably benign Het
Rnf146 T C 10: 29,347,644 D82G probably benign Het
Rpgrip1 A G 14: 52,140,559 S455G probably benign Het
Samm50 T C 15: 84,195,856 probably null Het
Sh3bgr A G 16: 96,205,922 K31E probably benign Het
Slc39a8 T C 3: 135,886,911 I449T probably damaging Het
Slc5a3 A T 16: 92,079,017 Y654F probably benign Het
Spata1 T A 3: 146,476,222 L264F possibly damaging Het
Spats2l A T 1: 57,799,353 probably benign Het
Stard13 A C 5: 151,047,599 S848A probably damaging Het
Stat2 A G 10: 128,276,565 S25G possibly damaging Het
Tet2 C T 3: 133,480,289 R1129Q possibly damaging Het
Tmem232 T C 17: 65,256,389 T670A probably benign Het
Tmem266 T C 9: 55,396,599 L3P unknown Het
Tns3 A T 11: 8,492,793 D523E probably benign Het
Trim3 A T 7: 105,617,808 S455T probably damaging Het
Trim31 T C 17: 36,909,662 V490A probably damaging Het
Trmt11 A C 10: 30,590,043 N168K probably benign Het
Trpc4 G A 3: 54,291,232 V526M probably damaging Het
Ttn C A 2: 76,919,138 D3856Y possibly damaging Het
Tulp2 G A 7: 45,519,803 D377N probably damaging Het
Ubl7 A G 9: 57,914,592 T75A probably damaging Het
Ugt2b34 T G 5: 86,901,275 D297A possibly damaging Het
Usp34 A T 11: 23,364,458 H800L possibly damaging Het
Utp3 C A 5: 88,555,553 L314M probably damaging Het
Zer1 A G 2: 30,113,325 Y27H probably damaging Het
Other mutations in Pfas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Pfas APN 11 69003814 nonsense probably null
IGL01287:Pfas APN 11 69001260 missense probably benign 0.09
IGL01712:Pfas APN 11 68991060 missense probably benign 0.34
IGL02019:Pfas APN 11 68993463 unclassified probably benign
IGL02053:Pfas APN 11 68992953 missense probably damaging 1.00
IGL02718:Pfas APN 11 69000145 splice site probably benign
IGL02801:Pfas APN 11 68988277 unclassified probably benign
Surf UTSW 11 68988021 missense probably damaging 1.00
PIT4812001:Pfas UTSW 11 68990036 missense
R0037:Pfas UTSW 11 69000036 missense probably damaging 1.00
R0046:Pfas UTSW 11 68990467 missense probably benign
R0046:Pfas UTSW 11 68990467 missense probably benign
R0408:Pfas UTSW 11 69001105 critical splice donor site probably null
R0532:Pfas UTSW 11 69002629 splice site probably benign
R0707:Pfas UTSW 11 68998037 missense probably benign 0.00
R0783:Pfas UTSW 11 69000521 missense probably damaging 1.00
R0946:Pfas UTSW 11 68993295 critical splice donor site probably null
R0946:Pfas UTSW 11 68990747 unclassified probably null
R1470:Pfas UTSW 11 68991359 missense probably benign
R1470:Pfas UTSW 11 68991359 missense probably benign
R1507:Pfas UTSW 11 68990034 missense probably benign 0.06
R1699:Pfas UTSW 11 68998046 critical splice acceptor site probably null
R1870:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1871:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1959:Pfas UTSW 11 68994284 missense probably damaging 1.00
R2026:Pfas UTSW 11 68993957 missense probably damaging 1.00
R2180:Pfas UTSW 11 68992187 missense possibly damaging 0.92
R3808:Pfas UTSW 11 68989953 intron probably benign
R3809:Pfas UTSW 11 68989953 intron probably benign
R3872:Pfas UTSW 11 69000263 missense probably damaging 1.00
R3906:Pfas UTSW 11 68988286 unclassified probably benign
R4092:Pfas UTSW 11 68993949 missense probably benign
R4437:Pfas UTSW 11 68988417 missense probably damaging 1.00
R4599:Pfas UTSW 11 68991069 missense probably benign 0.15
R4763:Pfas UTSW 11 68990194 missense possibly damaging 0.81
R5116:Pfas UTSW 11 68990990 intron probably benign
R5310:Pfas UTSW 11 68988021 missense probably damaging 1.00
R5328:Pfas UTSW 11 68988592 missense probably damaging 1.00
R5351:Pfas UTSW 11 68991391 missense probably damaging 1.00
R5427:Pfas UTSW 11 69001153 missense possibly damaging 0.90
R5533:Pfas UTSW 11 68991470 missense probably benign 0.02
R5602:Pfas UTSW 11 68991045 missense probably benign 0.05
R5637:Pfas UTSW 11 68993323 missense probably damaging 1.00
R5645:Pfas UTSW 11 68991132 missense probably damaging 1.00
R6149:Pfas UTSW 11 68991945 missense probably benign 0.07
R6295:Pfas UTSW 11 68997999 missense probably benign 0.36
R6305:Pfas UTSW 11 69001197 missense possibly damaging 0.51
R6387:Pfas UTSW 11 69000465 missense probably damaging 1.00
R6425:Pfas UTSW 11 68991071 missense probably benign 0.17
R6523:Pfas UTSW 11 68990457 missense probably benign
R6914:Pfas UTSW 11 68992181 missense probably benign 0.01
R6915:Pfas UTSW 11 68992181 missense probably benign 0.01
R6945:Pfas UTSW 11 69000530 missense probably benign
R6957:Pfas UTSW 11 68993883 missense probably benign 0.14
R7025:Pfas UTSW 11 68990760 missense probably benign 0.01
R7257:Pfas UTSW 11 68992959 missense probably damaging 1.00
R7386:Pfas UTSW 11 69003774 missense probably benign
R7424:Pfas UTSW 11 69000092 missense probably damaging 1.00
R7593:Pfas UTSW 11 68991095 missense
R7731:Pfas UTSW 11 69000045 missense probably damaging 1.00
Z1176:Pfas UTSW 11 68990070 missense
Z1176:Pfas UTSW 11 69002487 missense probably damaging 1.00
Z1177:Pfas UTSW 11 68990225 missense probably damaging 1.00
Z1177:Pfas UTSW 11 69002493 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACCGCCCAGACAGATTGTG -3'
(R):5'- ATAGAGGGCTGTCATGTCATTCC -3'

Sequencing Primer
(F):5'- CCAGACAGATTGTGGCGGAG -3'
(R):5'- AGATGAGCGCCTCAGATTTC -3'
Posted On2019-10-07