Mutagenetix > Incidental Mutations

Incidental Mutation 'R7459:Rims2'

578350

Institutional Source

Beutler Lab

Gene Symbol

Rims2

Ensembl Gene

ENSMUSG00000037386

Gene Name

regulating synaptic membrane exocytosis 2

Synonyms

2810036I15Rik, Syt3-rs, RIM2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.547) question?

Stock #

R7459 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

39198261-39684372 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 39517839 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1055 (S1055R)

Ref Sequence

ENSEMBL: ENSMUSP00000048719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243]

Predicted Effect

probably benign
Transcript: ENSMUST00000042917
AA Change: S1055R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386
AA Change: S1055R

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	30	154	9.5e-18	PFAM
low complexity region	315	335	N/A	INTRINSIC
low complexity region	492	498	N/A	INTRINSIC
low complexity region	511	521	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
PDZ	646	725	8.27e-16	SMART
low complexity region	740	748	N/A	INTRINSIC
C2	790	897	4.08e-21	SMART
low complexity region	905	919	N/A	INTRINSIC
low complexity region	1085	1101	N/A	INTRINSIC
low complexity region	1116	1130	N/A	INTRINSIC
low complexity region	1208	1238	N/A	INTRINSIC
C2	1432	1535	3.78e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000082054

SMART Domains

Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	76	194	2.2e-11	PFAM
low complexity region	355	375	N/A	INTRINSIC
low complexity region	532	538	N/A	INTRINSIC
low complexity region	551	561	N/A	INTRINSIC
low complexity region	567	580	N/A	INTRINSIC
PDZ	686	765	8.27e-16	SMART
low complexity region	780	788	N/A	INTRINSIC
C2	830	937	4.08e-21	SMART
low complexity region	945	959	N/A	INTRINSIC
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1166	1196	N/A	INTRINSIC
C2	1390	1493	3.78e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227243

Predicted Effect

probably benign
Transcript: ENSMUST00000227381

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432K21Rik	T	G	8: 84,167,352	S383A	probably benign	Het
Adgre1	T	A	17: 57,449,933	V730E	probably damaging	Het
Agbl1	G	A	7: 76,420,066	D449N	not run	Het
Agr2	A	T	12: 35,997,453	E96V	probably benign	Het
Als2cr12	T	G	1: 58,691,752	E48D	possibly damaging	Het
Atp1a2	A	C	1: 172,287,295	S308A	probably benign	Het
Birc7	T	C	2: 180,929,357	S71P	possibly damaging	Het
Camk2g	T	C	14: 20,779,207	I73V	probably damaging	Het
Carf	C	A	1: 60,128,039	T177K	possibly damaging	Het
Ccdc191	C	T	16: 43,947,457	Q665*	probably null	Het
Cd79a	A	T	7: 24,899,142	T39S	possibly damaging	Het
Ces5a	C	A	8: 93,535,741		probably benign	Het
Dkk2	C	A	3: 132,175,029	T145N	probably benign	Het
Dot1l	C	T	10: 80,773,173	A188V	probably damaging	Het
Egfr	T	A	11: 16,896,967	V788D	probably damaging	Het
Esyt3	T	A	9: 99,358,064	H109L	probably benign	Het
Fam129c	T	A	8: 71,605,027	C516S	possibly damaging	Het
Fam234b	C	T	6: 135,211,901	T168I	probably benign	Het
Fan1	G	T	7: 64,348,966	S936Y	probably damaging	Het
Fat2	T	C	11: 55,303,919	E1098G	probably damaging	Het
Fcgbp	A	G	7: 28,107,285	D2226G	possibly damaging	Het
Flvcr2	T	C	12: 85,747,057	V69A	probably benign	Het
Foxb2	T	A	19: 16,873,072	H190L	unknown	Het
Fut4	C	T	9: 14,751,306	V231M	possibly damaging	Het
Gtf2a1	G	A	12: 91,575,652	A91V	probably benign	Het
Hip1	A	G	5: 135,414,297	S961P	probably damaging	Het
Hsf2bp	C	T	17: 31,946,734	V296M	probably benign	Het
Hspbp1	G	T	7: 4,684,578	H11Q	probably benign	Het
Ighv1-84	C	T	12: 115,980,812	E81K	probably benign	Het
Isg20l2	T	C	3: 87,932,178	L232P	possibly damaging	Het
Isx	A	G	8: 74,892,764	Y181C	probably benign	Het
Kif9	A	G	9: 110,519,041	Y644C	probably damaging	Het
Lin7c	T	A	2: 109,897,337	V177D	probably benign	Het
Lpin3	T	C	2: 160,897,300	S343P	probably benign	Het
Mat1a	A	T	14: 41,120,184	Q246L	probably benign	Het
Mlkl	T	C	8: 111,333,530	I75V	probably benign	Het
Ndufa7	T	A	17: 33,838,166	S107T	probably damaging	Het
Nip7	T	A	8: 107,057,336	C69*	probably null	Het
Nipa2	A	T	7: 55,933,341	W219R	probably damaging	Het
Oas2	A	C	5: 120,749,710	S22A	unknown	Het
Obscn	A	G	11: 59,131,657	V754A	probably benign	Het
Olfr1249	G	A	2: 89,630,668	P77S	probably damaging	Het
Osbpl1a	C	T	18: 12,933,585	C39Y	probably damaging	Het
Pcdhb16	A	T	18: 37,479,553	Y522F	probably benign	Het
Pced1a	T	G	2: 130,419,824	D303A	possibly damaging	Het
Peli1	T	A	11: 21,148,190	Y308*	probably null	Het
Pfas	T	A	11: 68,988,655	R243W		Het
Pik3r5	C	A	11: 68,492,590	Q412K	probably benign	Het
Pkd1l1	A	T	11: 8,902,428	I1135N		Het
Prune1	C	A	3: 95,281,710		probably benign	Het
Ptpn4	T	A	1: 119,659,834	K926N	probably damaging	Het
Ptpre	A	G	7: 135,667,600	N277S	probably benign	Het
Raver2	A	T	4: 101,107,213	D255V	possibly damaging	Het
Rgs20	A	G	1: 4,910,634	V187A	probably benign	Het
Rgs3	A	G	4: 62,625,154	E242G	probably benign	Het
Rnf146	T	C	10: 29,347,644	D82G	probably benign	Het
Rpgrip1	A	G	14: 52,140,559	S455G	probably benign	Het
Samm50	T	C	15: 84,195,856		probably null	Het
Sh3bgr	A	G	16: 96,205,922	K31E	probably benign	Het
Slc39a8	T	C	3: 135,886,911	I449T	probably damaging	Het
Slc5a3	A	T	16: 92,079,017	Y654F	probably benign	Het
Spata1	T	A	3: 146,476,222	L264F	possibly damaging	Het
Spats2l	A	T	1: 57,799,353		probably benign	Het
Stard13	A	C	5: 151,047,599	S848A	probably damaging	Het
Stat2	A	G	10: 128,276,565	S25G	possibly damaging	Het
Tet2	C	T	3: 133,480,289	R1129Q	possibly damaging	Het
Tmem232	T	C	17: 65,256,389	T670A	probably benign	Het
Tmem266	T	C	9: 55,396,599	L3P	unknown	Het
Tns3	A	T	11: 8,492,793	D523E	probably benign	Het
Trim3	A	T	7: 105,617,808	S455T	probably damaging	Het
Trim31	T	C	17: 36,909,662	V490A	probably damaging	Het
Trmt11	A	C	10: 30,590,043	N168K	probably benign	Het
Trpc4	G	A	3: 54,291,232	V526M	probably damaging	Het
Ttn	C	A	2: 76,919,138	D3856Y	possibly damaging	Het
Tulp2	G	A	7: 45,519,803	D377N	probably damaging	Het
Ubl7	A	G	9: 57,914,592	T75A	probably damaging	Het
Ugt2b34	T	G	5: 86,901,275	D297A	possibly damaging	Het
Usp34	A	T	11: 23,364,458	H800L	possibly damaging	Het
Utp3	C	A	5: 88,555,553	L314M	probably damaging	Het
Zer1	A	G	2: 30,113,325	Y27H	probably damaging	Het

Other mutations in Rims2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Rims2	APN	15	39459615	missense	probably benign	0.11
IGL00502:Rims2	APN	15	39506984	missense	probably damaging	1.00
IGL00556:Rims2	APN	15	39456674	splice site	probably null
IGL00811:Rims2	APN	15	39292149	missense	probably damaging	1.00
IGL00827:Rims2	APN	15	39472359	missense	probably damaging	0.99
IGL01642:Rims2	APN	15	39457796	missense	probably damaging	1.00
IGL02951:Rims2	APN	15	39534938	missense	probably damaging	1.00
IGL03009:Rims2	APN	15	39566997	missense	possibly damaging	0.85
IGL03080:Rims2	APN	15	39535903	missense	probably damaging	1.00
IGL03102:Rims2	APN	15	39459593	missense	possibly damaging	0.95
IGL03252:Rims2	APN	15	39452352	missense	probably benign
IGL03365:Rims2	APN	15	39476541	missense	probably damaging	1.00
IGL03393:Rims2	APN	15	39462613	splice site	probably null
IGL03409:Rims2	APN	15	39456733	missense	probably damaging	1.00
rhyme	UTSW	15	39452328	missense	probably damaging	1.00
PIT4486001:Rims2	UTSW	15	39476520	missense	possibly damaging	0.67
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0078:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R0367:Rims2	UTSW	15	39462615	splice site	probably null
R0401:Rims2	UTSW	15	39509632	splice site	probably benign
R0531:Rims2	UTSW	15	39567030	missense	probably damaging	1.00
R0791:Rims2	UTSW	15	39679625	splice site	probably benign
R0838:Rims2	UTSW	15	39681025	missense	probably benign	0.02
R1201:Rims2	UTSW	15	39616324	missense	possibly damaging	0.91
R1318:Rims2	UTSW	15	39517826	missense	probably damaging	0.99
R1457:Rims2	UTSW	15	39511314	missense	possibly damaging	0.63
R1619:Rims2	UTSW	15	39506986	missense	probably damaging	1.00
R1672:Rims2	UTSW	15	39292189	missense	probably benign	0.09
R1743:Rims2	UTSW	15	39679650	missense	probably benign	0.10
R1766:Rims2	UTSW	15	39462580	missense	probably damaging	0.99
R1779:Rims2	UTSW	15	39681702	missense	probably damaging	1.00
R1804:Rims2	UTSW	15	39437043	nonsense	probably null
R1985:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R1986:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R2113:Rims2	UTSW	15	39511326	missense	probably benign	0.17
R2260:Rims2	UTSW	15	39478566	nonsense	probably null
R2510:Rims2	UTSW	15	39585652	missense	probably damaging	1.00
R3693:Rims2	UTSW	15	39478575	missense	probably benign	0.01
R3937:Rims2	UTSW	15	39437845	missense	probably damaging	1.00
R4425:Rims2	UTSW	15	39437924	critical splice donor site	probably null
R4453:Rims2	UTSW	15	39292208	missense	probably damaging	1.00
R4474:Rims2	UTSW	15	39462560	missense	probably damaging	1.00
R4518:Rims2	UTSW	15	39437526	missense	probably damaging	1.00
R4526:Rims2	UTSW	15	39437717	missense	probably damaging	1.00
R4833:Rims2	UTSW	15	39535914	missense	probably damaging	0.98
R4936:Rims2	UTSW	15	39437728	missense	probably damaging	1.00
R4993:Rims2	UTSW	15	39454445	missense	possibly damaging	0.90
R5001:Rims2	UTSW	15	39452428	missense	probably benign	0.03
R5054:Rims2	UTSW	15	39517869	splice site	probably null
R5072:Rims2	UTSW	15	39462590	missense	probably benign	0.01
R5171:Rims2	UTSW	15	39437103	missense	probably damaging	1.00
R5429:Rims2	UTSW	15	39345355	missense	probably damaging	1.00
R5623:Rims2	UTSW	15	39478615	missense	probably damaging	1.00
R5624:Rims2	UTSW	15	39345413	missense	possibly damaging	0.46
R5685:Rims2	UTSW	15	39437206	missense	possibly damaging	0.67
R5784:Rims2	UTSW	15	39535987	splice site	probably null
R5790:Rims2	UTSW	15	39681045	missense	probably damaging	1.00
R5822:Rims2	UTSW	15	39476490	missense	probably damaging	1.00
R5963:Rims2	UTSW	15	39437182	missense	probably damaging	1.00
R5988:Rims2	UTSW	15	39292182	missense	probably damaging	1.00
R6057:Rims2	UTSW	15	39675020	missense	probably damaging	1.00
R6239:Rims2	UTSW	15	39198363	start codon destroyed	unknown
R6407:Rims2	UTSW	15	39452328	missense	probably damaging	1.00
R6418:Rims2	UTSW	15	39509696	missense	probably damaging	1.00
R6495:Rims2	UTSW	15	39517812	missense	probably benign	0.01
R6502:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R6753:Rims2	UTSW	15	39566973	missense	possibly damaging	0.74
R6855:Rims2	UTSW	15	39345515	missense	probably benign	0.06
R6948:Rims2	UTSW	15	39511341	missense	probably benign
R7058:Rims2	UTSW	15	39585648	missense	probably damaging	1.00
R7167:Rims2	UTSW	15	39437077	missense	probably benign
R7217:Rims2	UTSW	15	39476489	missense	probably damaging	0.99
R7223:Rims2	UTSW	15	39437032	missense	probably benign	0.30
R7289:Rims2	UTSW	15	39437718	missense	probably benign	0.00
R7663:Rims2	UTSW	15	39507026	missense	probably damaging	1.00
R7792:Rims2	UTSW	15	39198528	missense	possibly damaging	0.69
R7836:Rims2	UTSW	15	39681079	missense	probably damaging	1.00
R8082:Rims2	UTSW	15	39476523	missense	probably benign	0.34
R8489:Rims2	UTSW	15	39616450	missense	probably damaging	1.00
X0034:Rims2	UTSW	15	39437534	missense	probably benign
Z1177:Rims2	UTSW	15	39437769	missense	probably benign	0.24
Z1177:Rims2	UTSW	15	39478690	frame shift	probably null
Z1177:Rims2	UTSW	15	39681114	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAAGATTTTCCAGTAGCAGTTTTC -3'
(R):5'- ATGATGGCATCTGTAATAGCTCTC -3'

Sequencing Primer
(F):5'- TCCAGTAGCAGTTTTCATTTGC -3'
(R):5'- AAAGATGATTCTAGTCCATCAAACAG -3'

Posted On

2019-10-07