Incidental Mutation 'R7460:Fbh1'
ID 578365
Institutional Source Beutler Lab
Gene Symbol Fbh1
Ensembl Gene ENSMUSG00000058594
Gene Name F-box DNA helicase 1
Synonyms Fbx18, Fbxo18
MMRRC Submission 045534-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.447) question?
Stock # R7460 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 11747384-11782393 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 11761496 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 597 (G597D)
Ref Sequence ENSEMBL: ENSMUSP00000071495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071564] [ENSMUST00000131893]
AlphaFold Q8K2I9
Predicted Effect probably benign
Transcript: ENSMUST00000071564
AA Change: G597D

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594
AA Change: G597D

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131893
AA Change: G41D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000116392
Gene: ENSMUSG00000058594
AA Change: G41D

DomainStartEndE-ValueType
SCOP:d1pjr_1 63 141 5e-9 SMART
Meta Mutation Damage Score 0.0762 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi2 T A 1: 60,473,466 (GRCm39) V61D probably damaging Het
Agrn C A 4: 156,258,881 (GRCm39) V915L probably damaging Het
Arhgap24 T C 5: 103,040,212 (GRCm39) V476A probably benign Het
Arhgef15 A G 11: 68,837,861 (GRCm39) L720P probably damaging Het
Atad2b C A 12: 5,002,660 (GRCm39) R343S probably benign Het
Atxn3 T A 12: 101,892,776 (GRCm39) T313S probably benign Het
BC051665 T C 13: 60,932,457 (GRCm39) E76G probably benign Het
Birc2 A T 9: 7,818,762 (GRCm39) F610I probably damaging Het
Cdh16 A T 8: 105,348,923 (GRCm39) V58D possibly damaging Het
Cenpf T C 1: 189,386,247 (GRCm39) D2011G probably damaging Het
Ddb1 T C 19: 10,585,275 (GRCm39) probably null Het
Ddx1 A G 12: 13,281,440 (GRCm39) probably null Het
Disp2 A G 2: 118,620,261 (GRCm39) H331R probably damaging Het
Dmxl1 A G 18: 50,011,679 (GRCm39) T1279A probably benign Het
Dync1i2 T C 2: 71,081,230 (GRCm39) I473T probably damaging Het
Fam114a1 T G 5: 65,196,050 (GRCm39) V520G possibly damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fat2 T A 11: 55,169,789 (GRCm39) D2990V probably damaging Het
Fdxr A C 11: 115,167,680 (GRCm39) S12A probably benign Het
Fgf14 T A 14: 124,914,105 (GRCm39) R9W possibly damaging Het
Gnat3 A T 5: 18,204,656 (GRCm39) D103V Het
Hepacam2 G A 6: 3,487,199 (GRCm39) P53S probably benign Het
Inhca T C 9: 103,131,847 (GRCm39) N625D probably benign Het
Jmjd1c A G 10: 67,052,815 (GRCm39) T21A probably benign Het
Lama1 T C 17: 68,074,013 (GRCm39) C930R Het
Lrp1b T C 2: 40,488,478 (GRCm39) T4536A Het
Lrrc27 T A 7: 138,803,574 (GRCm39) V166E probably damaging Het
Mapk10 C T 5: 103,186,443 (GRCm39) V90I probably benign Het
Mfsd14b C T 13: 65,219,837 (GRCm39) G339D probably damaging Het
Mnt T A 11: 74,734,109 (GRCm39) M580K unknown Het
Mrc1 T C 2: 14,253,680 (GRCm39) S234P probably damaging Het
Mrps5 G A 2: 127,433,811 (GRCm39) V75I not run Het
Mrtfb G T 16: 13,218,840 (GRCm39) Q495H probably benign Het
Myo10 A G 15: 25,807,913 (GRCm39) D1845G probably damaging Het
Or3a1c A T 11: 74,046,672 (GRCm39) I231F probably damaging Het
Or51a25 A T 7: 102,373,028 (GRCm39) M223K probably benign Het
Or7a40 C A 16: 16,491,030 (GRCm39) A272S possibly damaging Het
Or8b3 T C 9: 38,314,649 (GRCm39) S160P possibly damaging Het
Pdhx G A 2: 102,877,124 (GRCm39) T95M probably damaging Het
Pigb C T 9: 72,945,957 (GRCm39) V72I probably damaging Het
Prr7 C A 13: 55,620,166 (GRCm39) P110Q unknown Het
Psg22 A G 7: 18,458,329 (GRCm39) D340G probably benign Het
Ptprn2 T C 12: 117,212,301 (GRCm39) S908P probably benign Het
Ros1 T C 10: 51,994,299 (GRCm39) Y1348C probably damaging Het
Rspry1 T C 8: 95,376,963 (GRCm39) I506T probably benign Het
Ryr2 T A 13: 11,720,596 (GRCm39) Y2684F probably benign Het
Sdr16c6 A G 4: 4,076,575 (GRCm39) probably null Het
Senp7 A G 16: 55,993,545 (GRCm39) T743A possibly damaging Het
Slc6a20b T C 9: 123,434,014 (GRCm39) I275V probably benign Het
Slc6a7 A G 18: 61,134,674 (GRCm39) I467T probably benign Het
Tacc2 A G 7: 130,226,363 (GRCm39) D1016G probably benign Het
Thsd7a A G 6: 12,554,933 (GRCm39) V317A Het
Tle3 A G 9: 61,320,366 (GRCm39) H598R probably damaging Het
Tmem102 A G 11: 69,694,949 (GRCm39) L341P probably damaging Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Trappc14 G A 5: 138,260,991 (GRCm39) T218M probably benign Het
Trhde T A 10: 114,249,168 (GRCm39) D866V probably damaging Het
Ttn A G 2: 76,581,617 (GRCm39) I23092T probably damaging Het
U2surp C A 9: 95,344,877 (GRCm39) V944L unknown Het
Urgcp T C 11: 5,666,622 (GRCm39) H615R possibly damaging Het
Vps45 T A 3: 95,955,699 (GRCm39) Y97F probably benign Het
Zc3h12c T C 9: 52,055,402 (GRCm39) T136A probably benign Het
Zfp948 A T 17: 21,808,677 (GRCm39) H623L probably damaging Het
Other mutations in Fbh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Fbh1 APN 2 11,762,334 (GRCm39) nonsense probably null
IGL02081:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02082:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02084:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02086:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02369:Fbh1 APN 2 11,751,969 (GRCm39) missense possibly damaging 0.61
IGL02584:Fbh1 APN 2 11,764,769 (GRCm39) missense probably benign 0.07
IGL03138:Fbh1 UTSW 2 11,754,320 (GRCm39) intron probably benign
R0384:Fbh1 UTSW 2 11,754,389 (GRCm39) missense probably damaging 1.00
R0479:Fbh1 UTSW 2 11,763,230 (GRCm39) missense probably damaging 1.00
R0972:Fbh1 UTSW 2 11,768,899 (GRCm39) splice site probably benign
R1420:Fbh1 UTSW 2 11,772,493 (GRCm39) missense probably benign 0.01
R1827:Fbh1 UTSW 2 11,768,699 (GRCm39) missense possibly damaging 0.88
R1832:Fbh1 UTSW 2 11,772,211 (GRCm39) missense probably benign 0.08
R1960:Fbh1 UTSW 2 11,762,339 (GRCm39) missense probably damaging 0.98
R2040:Fbh1 UTSW 2 11,774,706 (GRCm39) missense possibly damaging 0.66
R2044:Fbh1 UTSW 2 11,767,781 (GRCm39) missense possibly damaging 0.89
R2102:Fbh1 UTSW 2 11,763,100 (GRCm39) missense probably benign 0.18
R3236:Fbh1 UTSW 2 11,774,637 (GRCm39) missense probably damaging 1.00
R3975:Fbh1 UTSW 2 11,772,021 (GRCm39) missense possibly damaging 0.72
R4504:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4505:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4507:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4799:Fbh1 UTSW 2 11,760,558 (GRCm39) missense probably damaging 1.00
R4894:Fbh1 UTSW 2 11,767,771 (GRCm39) missense probably damaging 1.00
R4994:Fbh1 UTSW 2 11,769,041 (GRCm39) missense probably damaging 1.00
R5579:Fbh1 UTSW 2 11,753,804 (GRCm39) missense probably damaging 0.97
R5801:Fbh1 UTSW 2 11,774,637 (GRCm39) missense probably damaging 1.00
R6255:Fbh1 UTSW 2 11,753,257 (GRCm39) missense probably benign 0.31
R7011:Fbh1 UTSW 2 11,767,774 (GRCm39) missense probably damaging 1.00
R7177:Fbh1 UTSW 2 11,760,522 (GRCm39) missense probably damaging 1.00
R7243:Fbh1 UTSW 2 11,756,336 (GRCm39) missense probably benign 0.11
R7331:Fbh1 UTSW 2 11,768,797 (GRCm39) missense probably benign
R7361:Fbh1 UTSW 2 11,751,887 (GRCm39) missense probably damaging 1.00
R7541:Fbh1 UTSW 2 11,754,348 (GRCm39) missense probably benign 0.05
R8000:Fbh1 UTSW 2 11,772,100 (GRCm39) missense probably benign 0.21
R8010:Fbh1 UTSW 2 11,772,443 (GRCm39) missense probably benign 0.15
R8056:Fbh1 UTSW 2 11,748,441 (GRCm39) missense probably benign 0.01
R8517:Fbh1 UTSW 2 11,782,241 (GRCm39) critical splice donor site probably null
R8686:Fbh1 UTSW 2 11,760,469 (GRCm39) missense probably benign 0.00
R8883:Fbh1 UTSW 2 11,753,922 (GRCm39) missense probably benign 0.21
R9093:Fbh1 UTSW 2 11,764,801 (GRCm39) missense probably damaging 1.00
R9306:Fbh1 UTSW 2 11,772,387 (GRCm39) missense probably benign 0.00
R9342:Fbh1 UTSW 2 11,754,414 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAAGGTTTGCTCAGCTGCC -3'
(R):5'- CTCCGAGCACTTGAGATCTCAG -3'

Sequencing Primer
(F):5'- GCTGCCAGAGTTTCAAATAGCCTAG -3'
(R):5'- GCACTTGAGATCTCAGGGTTAAAAC -3'
Posted On 2019-10-07